ID: 968394654

View in Genome Browser
Species Human (GRCh38)
Location 4:223737-223759
Sequence CTCTGGGGTTGCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 3, 1: 2, 2: 5, 3: 66, 4: 478}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968394647_968394654 11 Left 968394647 4:223703-223725 CCCATTTGTTTGGTCCACAGGCT No data
Right 968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG 0: 3
1: 2
2: 5
3: 66
4: 478
968394649_968394654 -3 Left 968394649 4:223717-223739 CCACAGGCTGATGAGATTACCTC No data
Right 968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG 0: 3
1: 2
2: 5
3: 66
4: 478
968394648_968394654 10 Left 968394648 4:223704-223726 CCATTTGTTTGGTCCACAGGCTG No data
Right 968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG 0: 3
1: 2
2: 5
3: 66
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968394654 Original CRISPR CTCTGGGGTTGCAGAGAAGA AGG Intergenic
900912177 1:5606247-5606269 CTCAGGGGTAGCAGAGGTGAAGG + Intergenic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901144845 1:7057901-7057923 ATCTGGGGGTCCAGAGAAGGGGG - Intronic
902482917 1:16720969-16720991 CTCAGGTGTTGCAGAGCTGATGG - Intergenic
902521866 1:17022802-17022824 CTCTGGGAGTGCAGAGGAAAGGG + Intronic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902937483 1:19774886-19774908 CTCTGGGGTCCCAGAGATGTAGG - Intronic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
904433697 1:30480537-30480559 CTCTGTGGTTGCACAGAGGTTGG - Intergenic
904473473 1:30749931-30749953 CTCTGGGGTTAGAGAGAAAGGGG + Intronic
904592307 1:31621696-31621718 CTCTTTGGTTGCAGCCAAGATGG - Intronic
904839749 1:33364676-33364698 CTCTGGGCTTACAGAGAGGAAGG + Intronic
905216824 1:36414549-36414571 ATCAGGTGCTGCAGAGAAGATGG - Intergenic
905283565 1:36864705-36864727 CTCAGGGGTTACAGGGAGGAAGG - Intronic
905309903 1:37042191-37042213 CTGTGGGGTTGCTGAGTTGAGGG + Intergenic
905989607 1:42323610-42323632 CTATGGGTTTACTGAGAAGAGGG - Intronic
906543452 1:46605351-46605373 CTCTGGGGGTGCTCAGAGGAAGG + Intronic
906792546 1:48671238-48671260 ATCTGAGGTTTCAGACAAGAAGG + Intronic
906929056 1:50150602-50150624 CTATTGGGTTGAAGAGGAGAGGG + Intronic
907620596 1:55974305-55974327 CTCTGGGGATGTAAAGATGAAGG - Intergenic
907727602 1:57034304-57034326 CACTGAGCTTGCAGAGATGAGGG - Intronic
908518299 1:64915906-64915928 TTCTGGAGCTGCAGGGAAGAGGG - Intronic
910708946 1:90158734-90158756 CCCTGGGGTTGCTGAAAAGCAGG - Intergenic
911144994 1:94542575-94542597 CTCTGTGGTTCCAGAAAGGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913296884 1:117330420-117330442 CTCAGGAGTTGCAGAGAATAGGG - Intergenic
913322417 1:117598342-117598364 CTGTGGGGTTTCAGAGCAGGAGG - Intergenic
913322575 1:117599535-117599557 GTCTGAGGATGCAGAGACGAGGG + Intergenic
915135470 1:153728407-153728429 CTCTGGGGTGGCAGTGCTGAGGG - Exonic
915237034 1:154491490-154491512 TTGTGGGGTATCAGAGAAGAAGG - Intronic
916519844 1:165553726-165553748 CTCTGGGACTGCAGAGAAGGAGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916799305 1:168200795-168200817 CTCTGAGGTTGCATGGAAGATGG - Exonic
917056391 1:170986547-170986569 CTTTGTGGTTGCAGAGAGTAGGG + Exonic
917924925 1:179781598-179781620 CGCTGGGATTGCAGGGATGAGGG + Intronic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918168236 1:181970857-181970879 CTCTGGATTTACATAGAAGACGG + Intergenic
919838309 1:201591758-201591780 CTCTTGGGGGGCACAGAAGAGGG - Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920660779 1:207912389-207912411 CGTTGGGGTTGCACAGGAGAAGG + Intergenic
920769030 1:208863023-208863045 CTCTGGGGGTTCGGGGAAGAAGG + Intergenic
921436925 1:215134498-215134520 CTTTGGGGTTGCAGAACACATGG - Intronic
921829001 1:219706233-219706255 CCGTGAGGTTGCAGAGAAGAAGG + Intronic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
923080268 1:230646593-230646615 ACATGGGGTTGCAGATAAGAAGG - Intronic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
923573506 1:235137727-235137749 CTCTGTGGTTACAGAGTTGATGG - Intronic
923819792 1:237425774-237425796 CTTAGGGGTGGCAGAGATGAAGG + Intronic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1062958422 10:1555349-1555371 TTGTGAGGTTGCAGAGAAAAGGG - Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063379325 10:5574609-5574631 CTCAGGGGTGGCTGAGAGGATGG - Intergenic
1064509533 10:16074635-16074657 TTCTGGGGTAGGCGAGAAGATGG - Intergenic
1064970137 10:21057201-21057223 ATATGGGGTTTCAGAGAAAAGGG + Intronic
1066171461 10:32852253-32852275 CCCTGGGGTTGCATAAAAGAGGG - Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1069059227 10:63876414-63876436 TGCTGAGGTTGCAGAGAAAAGGG - Intergenic
1069407472 10:68117324-68117346 CTATGTGGGTGCAGAGACGATGG + Intronic
1069517317 10:69088264-69088286 CACAGGGCTTACAGAGAAGATGG - Intronic
1069723191 10:70562326-70562348 CTCCAGGGTCGCAGAGTAGATGG - Intronic
1069734746 10:70646583-70646605 TGCTGAGGTTGGAGAGAAGATGG + Intergenic
1069786093 10:70988838-70988860 GTCTGGGGTTGCAGAGATTGAGG + Intergenic
1069863552 10:71486300-71486322 CTCTGGGATTACAGAGGAAAGGG + Intronic
1071457147 10:85859746-85859768 TGCTGAGGTTGGAGAGAAGATGG - Intronic
1071743487 10:88388819-88388841 CTCTGGGGATACAGTGATGAGGG - Intronic
1071807282 10:89137747-89137769 TGCTGAGGTTGCAGAGAAAAAGG + Intergenic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074214541 10:111371421-111371443 TGGTGGGGTTGCAGAGAAAAGGG - Intergenic
1074476936 10:113781835-113781857 CTGTGGGGTTGAAGAGAGGCAGG - Intronic
1075440847 10:122478296-122478318 TTCTGGCATTGCAGAGAGGATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076485225 10:130811365-130811387 CGCTGAGGTTGCAGAGGAGGAGG - Intergenic
1077354648 11:2109448-2109470 CCCTGGGGCTGCAGACAAGCTGG + Intergenic
1079635380 11:22732517-22732539 ATCTGAGGCTGCTGAGAAGAAGG - Intronic
1079699680 11:23529200-23529222 CTCTGGGGTGGCAAATCAGATGG - Intergenic
1079809718 11:24982118-24982140 TTGTGAGGTTGCAGAGAAAAGGG + Intronic
1080178510 11:29394933-29394955 CTCTTGGGCTGCAGAGATGGGGG + Intergenic
1081489665 11:43557761-43557783 CTCGGGGGCGGCAGAGAAGGAGG + Intronic
1082225302 11:49698892-49698914 CACTGGGGTCTCAGAGAACAAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1084012305 11:66359215-66359237 CTCTGGGGCTGCAATGAAAAGGG + Intronic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084418763 11:69049710-69049732 CTCTGGGGTGGCAGAGGGCAAGG - Intronic
1085290699 11:75397162-75397184 TTCTGTGGTTGCTGAGCAGAGGG - Intergenic
1086520546 11:87663626-87663648 CTCTGTGGATGCTGAGAAGTGGG + Intergenic
1087942437 11:104115054-104115076 CTTTGGGGTCTCAGGGAAGAGGG - Intronic
1088783277 11:113156775-113156797 CTCTGAGGTGGTAGAGAAGGAGG + Intronic
1088804308 11:113337905-113337927 ATCTAGGGTTGAAGAGAAGTTGG + Intronic
1089508187 11:118979070-118979092 TTCTGGGGTGGCTGAGAGGAGGG - Exonic
1089740972 11:120582990-120583012 TGCTGAGGTTGCAGAGAAAAGGG - Intronic
1089783903 11:120894541-120894563 CCCAGGGGTTGCAGTGAAGGAGG - Intronic
1090706953 11:129346465-129346487 CTTTGGCGTTGCAGCTAAGAAGG - Intergenic
1090974727 11:131671452-131671474 CTCTGGGCTTGCAGAGAATGTGG + Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091402406 12:189000-189022 GTCTGGGGCAGCAGAGAGGATGG + Intergenic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1093837858 12:23858553-23858575 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
1095412712 12:41941722-41941744 CTCTTGTGTTGAAGAGGAGAGGG - Intergenic
1095903292 12:47350895-47350917 GTCTGGGGTTGCATAGCTGACGG - Intergenic
1096243586 12:49972458-49972480 CTGTGGGGTTGCAGAGGGGCGGG - Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096802449 12:54120114-54120136 TTTTGGGCTTGCAGAGAGGACGG - Intergenic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097734218 12:63164406-63164428 CTCTGGGGTTGCGGTGAGGGAGG + Intergenic
1097954578 12:65470406-65470428 CTCTGGTGTTAAAGAGAAGGGGG - Intronic
1098047448 12:66415428-66415450 CGGTGAGGTTGCAGAGAAAAAGG + Intronic
1098938836 12:76511376-76511398 TGCTGAGGTTGCAGAGAAAAGGG - Intronic
1099029659 12:77510441-77510463 CACTGTGGTTGAAGAAAAGAGGG - Intergenic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099991326 12:89724227-89724249 CTCTGGGGTTTATCAGAAGAAGG + Intergenic
1101209363 12:102520833-102520855 CTCTAGGATTGCATACAAGATGG + Intergenic
1102310389 12:111840432-111840454 CTCAGGGGTTGGAGAGCAGCCGG + Intergenic
1102925938 12:116826424-116826446 CTCTGGGGCTTCAGAGAACAAGG - Intronic
1103032710 12:117630298-117630320 CCCTGGGGTTGAAGACAATATGG + Intronic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103916731 12:124379596-124379618 CTCTGGGGTTGCTGAGAAAGAGG + Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104469859 12:129020973-129020995 CTTTGGGGGTGAAGAGAGGAAGG - Intergenic
1104823415 12:131692215-131692237 CTCCGGGGTTGGAGAGGGGAGGG + Intergenic
1104951959 12:132445190-132445212 CCCTGGGGTGGAGGAGAAGATGG - Intergenic
1105265196 13:18809050-18809072 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1105306200 13:19170689-19170711 CTCTGGGGGTGGAGAGACAAAGG - Intergenic
1106153531 13:27130083-27130105 CTCTGGGGATGCTGAGGAGTAGG - Intronic
1107309037 13:39056712-39056734 TGGTGGGGTTGCAGAGAAAAGGG - Intergenic
1107800874 13:44107032-44107054 CTGAGGGGTGGCAGAGGAGAGGG - Intergenic
1108342033 13:49506639-49506661 CTTTCAGGTTGCAGAAAAGATGG + Exonic
1108640523 13:52378750-52378772 CCCTGGGGCTGAAGAGGAGATGG + Exonic
1109133217 13:58613976-58613998 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1109528346 13:63605993-63606015 CTCTGGGGCTGTGGAAAAGAGGG - Intergenic
1109703248 13:66054958-66054980 TGGTGGGGTTGCAGAGAAAAGGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113585669 13:111462510-111462532 CTCTAGGCTGGCAGAGAAGACGG - Intergenic
1114067714 14:19078771-19078793 TGCTGAGGTTGCAGAGAAAAGGG - Intergenic
1114094543 14:19321255-19321277 TGCTGAGGTTGCAGAGAAAAGGG + Intergenic
1116024789 14:39502082-39502104 CGGTGAGGTTGCAGAGAAAAGGG - Intergenic
1116374163 14:44176287-44176309 CTCGGGGATAGCAGAGATGAAGG - Intergenic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1116883004 14:50190961-50190983 CTCTGGTGGGGAAGAGAAGAGGG - Intronic
1118390222 14:65289273-65289295 CACTGGGGTTGCAAAGCTGAGGG + Intergenic
1118480460 14:66159686-66159708 CCCTGGGGTTGGAGAGAACATGG + Intergenic
1119876868 14:78067566-78067588 TGGTGAGGTTGCAGAGAAGAGGG - Intergenic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1121335143 14:93073325-93073347 CACAGGGGTGGCAGGGAAGAAGG + Intronic
1121829891 14:97042142-97042164 CAGTGGGGTGCCAGAGAAGAAGG - Intergenic
1122157479 14:99758883-99758905 CTCTGGGTTTGCAAAGAAATTGG + Intronic
1122293806 14:100693888-100693910 CTCAGGAGCTGCAGAGAAGGGGG - Intergenic
1123796197 15:23773327-23773349 TTATGAGGTTGCAGAGAAAAGGG - Intergenic
1124115694 15:26841755-26841777 CTCTGCAGTGGCAGGGAAGATGG + Intronic
1124230684 15:27943692-27943714 ATATGGGGTTGCAGAGACCAAGG - Intronic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1125408650 15:39381753-39381775 CGGTGAGGTTGCAGAGAAAAGGG + Intergenic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1125969193 15:43898350-43898372 CTCTGAAGATGCAGACAAGAAGG - Intronic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1126993383 15:54410008-54410030 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1127103895 15:55592984-55593006 TTCTGGGGTTGCAGAGAAAAAGG - Intergenic
1127292411 15:57582189-57582211 CTCTGAGGTTGCAGTGAAGCAGG + Intergenic
1127326098 15:57896589-57896611 CTTGGGGCTTGAAGAGAAGAAGG - Intergenic
1127732784 15:61815862-61815884 CTAAGGGGTTGCTGAGAGGACGG - Intergenic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1130316800 15:82803125-82803147 CTCTGGGGTCCCAGGAAAGAGGG - Intronic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1130985717 15:88843289-88843311 CTCTGGGGATGCAGAGCAGGGGG + Intronic
1131647611 15:94362055-94362077 CACTGGGGTTGGTGAGATGAAGG + Intronic
1131763103 15:95645770-95645792 CTCGGGAATTGCATAGAAGAGGG - Intergenic
1132841004 16:1978531-1978553 CTCTGGGGTTGGACAGAGGGAGG - Exonic
1134231681 16:12434908-12434930 TTCTGGGGTCCCAGAGAAAAGGG + Intronic
1134615908 16:15650780-15650802 GTCTGGGGTCGCAGAGAAGCGGG - Intronic
1134819468 16:17234723-17234745 CCTTAGGGTTGCAGAGAAGATGG - Intronic
1135038942 16:19102766-19102788 CTTTGGTGTGGCAGAGATGAAGG - Intergenic
1137389827 16:48072071-48072093 CTCTGGGGTTGCTGTCACGAGGG + Intergenic
1137626642 16:49912948-49912970 GTCTGGGGTTGCAGAGCAGGAGG + Intergenic
1137761268 16:50942394-50942416 CTCAGGGATTGCAGAGAGAATGG - Intergenic
1137849045 16:51720360-51720382 CACTGGGGTTTCAGGGAAGTGGG + Intergenic
1139149641 16:64366126-64366148 CACTGAGGCTACAGAGAAGAAGG - Intergenic
1140352380 16:74274703-74274725 ATCTCGGGTAGCAGAGAAGGTGG - Intergenic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1140843928 16:78868678-78868700 CTCTGAGATTGAAGAGAGGAAGG + Intronic
1140873236 16:79126094-79126116 CCCTGGAGTTTCACAGAAGAAGG + Intronic
1140991222 16:80213492-80213514 CTCTGGGGTGGAAAAGATGAAGG + Intergenic
1141100615 16:81195181-81195203 CTCTGGGGACACAGAGATGAAGG + Intergenic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1141343967 16:83228423-83228445 CTCTGGGGCACCAGAGATGAAGG + Intronic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1141820317 16:86441315-86441337 CTCTGTGATTGCAGAAAATAGGG - Intergenic
1142758297 17:2028616-2028638 CCCTGGGGATCCAGAGAAGCTGG + Intergenic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143402905 17:6657435-6657457 CTCTGGGGTGCGAGAGAAGCTGG + Intergenic
1144090048 17:11848010-11848032 CTCTGGGCTTGAGGAGAAAAGGG - Intronic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147627434 17:41909198-41909220 AGCAGGGGTTGCAGAGGAGATGG - Intronic
1147755168 17:42762731-42762753 CTCTGGGGGGTCAGAGAAGGTGG - Exonic
1147782855 17:42956166-42956188 CTGTGGAGTGGCTGAGAAGAGGG - Intronic
1148960780 17:51390997-51391019 CCCAGGGGATGCAGAGCAGATGG + Intergenic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1150038125 17:61826765-61826787 CGGTGAGGTTGCAGAGAAAAAGG + Intronic
1150132534 17:62677116-62677138 CTCTGGGGTTGGAGCCAGGAGGG - Intronic
1150505894 17:65698873-65698895 CCCTGGGCTTGCACTGAAGAGGG - Intronic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152596969 17:81242525-81242547 ATTTGGGGTGGCAGAAAAGAGGG - Intergenic
1152926219 17:83088987-83089009 CTCTGGGCTTGTGGAGAGGAAGG + Intronic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1154423199 18:14252494-14252516 ATCTGGGGCTGCAGAGCAGCTGG - Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1156056172 18:33006716-33006738 CTCTGTCTTTGCAGATAAGAAGG + Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1157429779 18:47615219-47615241 CTATGGGGCTGCAGTGTAGAGGG + Intergenic
1157702080 18:49767812-49767834 GTCTGGAGCAGCAGAGAAGATGG - Intergenic
1158395866 18:57077998-57078020 CTCTGGGGTCCCAAAGAGGAAGG + Intergenic
1158434710 18:57427903-57427925 CTCCGGGCTTGCGGGGAAGAAGG - Intergenic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1160179163 18:76619454-76619476 CTCGGTGGTTACAGAGAAGCTGG + Intergenic
1160861657 19:1239818-1239840 CTCGGGGGGTGCAGAGGAGGAGG - Intergenic
1160875515 19:1294689-1294711 CTCTGGGGGTGCTGAGAGGAGGG + Intronic
1161797262 19:6394197-6394219 CTCTGAGGGCTCAGAGAAGAGGG + Intergenic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1162527668 19:11215926-11215948 CCCTGGGGGTGCAGAGAACTGGG + Exonic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163080898 19:14941461-14941483 CGCTGGGTTTGCCGAGAAGGAGG - Intergenic
1163186329 19:15641707-15641729 GTCTGGGGTGGCAGAGAAGCAGG + Intronic
1163499766 19:17669383-17669405 TTCTTGGGTTGCAGAGAACAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164479330 19:28599226-28599248 GTCTGAAGTTGCAGAGCAGAGGG - Intergenic
1164538531 19:29105361-29105383 GTCGGGGGTTGCTGGGAAGAAGG - Intergenic
1164756062 19:30690626-30690648 CTCTGGTGGTTCAGAGAGGAGGG + Intronic
1164844150 19:31417661-31417683 TTTTGGGGGAGCAGAGAAGATGG + Intergenic
1165243488 19:34484344-34484366 CCCTGGGGTTGCAGCCCAGAGGG + Intronic
1165969788 19:39617794-39617816 CTTTTGGGTTGCAGGGGAGATGG + Intergenic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166779163 19:45331396-45331418 CGCTGGTGTGGCAGAGAATAGGG + Intergenic
1166847114 19:45735323-45735345 CTCTGGGATTGCAGGAAGGATGG - Intronic
1167044198 19:47040421-47040443 CTGGGGGGTGACAGAGAAGAGGG - Intronic
1168318442 19:55494363-55494385 CTTAGGGGTGGCAGAGAAGCGGG - Intronic
1168695136 19:58400013-58400035 GCCTGGTGTTGCACAGAAGAGGG + Intergenic
925202778 2:1982321-1982343 GTCTGGGGATGCAGAGATAATGG + Intronic
925628973 2:5869287-5869309 CTCTTGGCTTTCAGAGAAAAGGG + Intergenic
926755985 2:16236383-16236405 CTCTTAGGTTGCAGTGGAGAGGG - Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
927651714 2:24917505-24917527 CTCAGGGGCTGCAGAGACCAGGG - Intronic
927844681 2:26465276-26465298 CTCTGAGGTTCCAGAGGAGTGGG - Intronic
929015697 2:37492301-37492323 TACTGAGGTTGCAGAGAAAAAGG - Intergenic
932211773 2:69937425-69937447 CTCTGGGGTTGGGGAGCACAAGG - Intronic
932323432 2:70838418-70838440 TTCTGGGGTTTCAGAGGAGGTGG + Intergenic
932581599 2:72995761-72995783 ACCTGGGGTTCCAGAGAACAAGG + Intronic
933354571 2:81196269-81196291 CCCTGGGGCTGCAGAGTGGAGGG + Intergenic
933721602 2:85400801-85400823 CTCTGGGGAGGCAGCCAAGATGG - Intronic
933737025 2:85503523-85503545 CTCAGGGGCAGCAGAGAACAGGG - Intergenic
933900541 2:86846591-86846613 CTCTAGGGGAGCAGAGCAGATGG - Intronic
934028905 2:88023969-88023991 CTTGGGGTTTTCAGAGAAGAAGG + Intergenic
934757406 2:96833612-96833634 CTATGGGGTTTTAGAGAAGTGGG + Exonic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
935082325 2:99810286-99810308 CTCTGGGGTTGCATAGCAACCGG - Intronic
935107243 2:100056165-100056187 CTCTGGTGTCACAGACAAGATGG - Intronic
935491153 2:103722085-103722107 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
935780006 2:106502634-106502656 CTCTAGGGGAGCAGAGCAGATGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936023351 2:109012459-109012481 CCCTGGGATTGCAAAGCAGAAGG + Intergenic
936238458 2:110766913-110766935 CTCTTGTCTTGCAGAGCAGATGG - Intronic
936852568 2:116918376-116918398 CTCTGGGGTTGTGGAGTGGAGGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937252441 2:120533450-120533472 CTCTCGGGGTGCAGAGGGGAGGG - Intergenic
937331495 2:121033051-121033073 GTCAGGGGTTGCAAAGAAGAAGG + Intergenic
937436832 2:121887991-121888013 CTATGGGGATGCTGAGAAGTGGG + Intergenic
938485358 2:131701374-131701396 TGCTGAGGTTGCAGAGAAAAGGG - Intergenic
938893445 2:135727919-135727941 CTCTTGGTTTGCAAAGAACATGG + Intergenic
938900638 2:135796297-135796319 CCCTGGGGTTTCTGAGATGATGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
939976484 2:148722532-148722554 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
940150005 2:150589289-150589311 CTCTGGAGTTCCAGAGTAGCTGG - Intergenic
940276883 2:151948863-151948885 CTGTGTGCTTGCAGAGTAGAAGG - Intronic
940838143 2:158548469-158548491 CCCTGTTGTTGCAGAGAAGCAGG + Intronic
941268994 2:163401684-163401706 ATCTGAGGTTGCATAAAAGAAGG + Intergenic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
942103225 2:172606685-172606707 CTCTGTGGTAGCAGAGAGAATGG + Intronic
942797440 2:179838546-179838568 CTTTGGAGTTGCAGAGGGGAAGG - Intronic
942821676 2:180122661-180122683 AACTGGGGCTGCAGAGAGGATGG - Intergenic
943520125 2:188938817-188938839 ATCTGGGTTGGCAGAGAAGGGGG - Intergenic
944085995 2:195848760-195848782 TTCTGTGGTTGCAAGGAAGAAGG + Intronic
944157581 2:196623448-196623470 CTCAGGAGTTGTAGAGAAGGAGG + Intergenic
944663954 2:201943895-201943917 CTCAGGGGTGGCAGAGATGGAGG + Intergenic
945520725 2:210824060-210824082 GTTTGGTGTTCCAGAGAAGAGGG - Intergenic
945639477 2:212405343-212405365 CGGTGAGGTTGCAGAGAAAAGGG + Intronic
946229664 2:218283421-218283443 CTCTGAGGTAGCAGAGATGCAGG + Intronic
946878363 2:224152846-224152868 TGGTGGGGTTGCAGAGAAAAGGG - Intergenic
948163854 2:235845901-235845923 CTCTGGGGGTGCAGGAAGGAGGG - Intronic
948340243 2:237244829-237244851 CTCTGGGCTAGCAAAGAATAAGG + Intergenic
1169451521 20:5716069-5716091 CTCAGGGGTTGCGGAGGTGAAGG + Intergenic
1169995957 20:11556911-11556933 ATCTGGGGATGCAGAAAACATGG - Intergenic
1170894036 20:20398361-20398383 GTCTGGGGATGCACAGGAGAGGG - Intronic
1170926830 20:20732778-20732800 CACTGGGGTTTCATAGCAGAAGG - Intergenic
1171886030 20:30652990-30653012 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1171987437 20:31670396-31670418 CACTGGGGTTGCAGCCAAAATGG + Intronic
1172843831 20:37917769-37917791 GCCTGGGGTTGCGGAGAAGGAGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174530918 20:51213293-51213315 CACTGGGGTTGCTGAGAAGTGGG - Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175889335 20:62309474-62309496 CTCTGGGGGCACAGGGAAGATGG + Exonic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176850273 21:13907515-13907537 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180486189 22:15801340-15801362 TGCTGAGGTTGCAGAGAAAAGGG - Intergenic
1180968184 22:19801307-19801329 CTCAGGGGCTGCAGAGACCATGG - Intronic
1181682011 22:24501849-24501871 CTGTGGGGTTGCTGAGAGGCAGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183439935 22:37817461-37817483 CTCAGGGGCTGCAGAGTAGCGGG - Intergenic
1183561565 22:38578685-38578707 CTCTGGGGTTGCGGGGATGGTGG + Intronic
1183806458 22:40215585-40215607 CCCTGAGGATGCAGCGAAGATGG - Intronic
1183953415 22:41365251-41365273 CCCCGGGGTTGCAGAGCAAAGGG + Intergenic
1184596146 22:45515379-45515401 CTCTGGGGCTGCTCAGAACATGG + Intronic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
1185213859 22:49587451-49587473 CCCTGGGATGGCAGAGAAGCTGG - Intronic
1185415285 22:50706057-50706079 CGGTGGGGCTGCAAAGAAGAGGG - Intergenic
950011433 3:9726911-9726933 CTCTGGGGTTCCTGGGAGGATGG + Intronic
950284020 3:11730834-11730856 ATGTGGTGGTGCAGAGAAGATGG - Intergenic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
952212277 3:31240184-31240206 CTCTTGGGCTCCAGAGAAAATGG - Intergenic
952972159 3:38658401-38658423 CTCTTTGGTGGTAGAGAAGAGGG + Intergenic
953024689 3:39138068-39138090 GTCTGGGGTAGCTGAGAGGAGGG + Intronic
953462262 3:43090815-43090837 CACTGGGGTGGCAGGGAGGAAGG + Intronic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
953941442 3:47102214-47102236 CTCTGGACTTGCAGAGATTAAGG + Intronic
954527720 3:51287644-51287666 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
955235682 3:57137037-57137059 CTTTGGGGTTGCGGAGGGGAAGG + Intronic
955785425 3:62532965-62532987 CTCTGAGGTAGCAGAGATGTCGG + Exonic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956729376 3:72182839-72182861 CGCTGGGGTTGGGGAGAACAAGG - Intergenic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959667090 3:108934373-108934395 CGCCGAGGCTGCAGAGAAGAAGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961011552 3:123439763-123439785 CCATGGGGTTGCAAAGATGACGG - Intronic
961658840 3:128457735-128457757 CGCTGGGCTTGCAGAGCAGGTGG - Intergenic
961988391 3:131161191-131161213 TTGTGAGGTTGCAGAGAAAAAGG + Intronic
962014388 3:131425214-131425236 CTCTGGGGTTGGAGATAGTATGG + Intergenic
962235777 3:133705978-133706000 CTCCAGGGTTGCTGAGAAGAGGG - Intergenic
966252960 3:177887451-177887473 CTCTGTGGTGGCAGAGTGGAGGG - Intergenic
966772634 3:183517671-183517693 CCCTGAGTTTCCAGAGAAGACGG + Intronic
967149649 3:186636985-186637007 CTATGTGGCTTCAGAGAAGAAGG - Intronic
967219921 3:187239869-187239891 CTATGGGATCCCAGAGAAGAAGG - Intronic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG + Intergenic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970261856 4:14233354-14233376 CTCTGCAGTTGCTGAGAAGCAGG + Intergenic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
972010618 4:34176488-34176510 TTGTGTGGTTGCAGAGAAAAGGG + Intergenic
974570131 4:63635161-63635183 CGGTGAGGTTGCAGAGAAAAGGG + Intergenic
974728378 4:65827031-65827053 CTGTGGAGTTACAGAAAAGAAGG - Intergenic
976683675 4:87786422-87786444 CCCAGGGGTTTCTGAGAAGAAGG + Intergenic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
978060875 4:104336689-104336711 TTGTGAGATTGCAGAGAAGAGGG - Intergenic
979433278 4:120658625-120658647 CTCTGGGCTTGCAAAAAAAAGGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
980802482 4:137769901-137769923 TTCAGGGGTTTCAGAGAAGCAGG + Intergenic
980873133 4:138632916-138632938 CTCAGGGGTGGCAGTAAAGATGG - Intergenic
982202815 4:152975718-152975740 CTCTGGGGTTGGAGAAATGGGGG + Exonic
982728921 4:158934712-158934734 CTCTTGGGTGGCAGAGTATATGG - Intronic
982794645 4:159630165-159630187 CTCTAGAGTTGCAAACAAGATGG - Intergenic
983917457 4:173307912-173307934 CTCTGGGGTTCCCCAGCAGAAGG + Intronic
984755213 4:183319786-183319808 CTCTTGGGTTGCCCACAAGACGG - Exonic
984755424 4:183321994-183322016 CTCTTGGGTTGCCCACAAGACGG - Exonic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
986055687 5:4134830-4134852 TGCTGAGGTTGCAGAGAAAAAGG + Intergenic
986233006 5:5884124-5884146 CTCTGGGCCTGCATAGAATAGGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
987419476 5:17701879-17701901 TTTTGAGGTTGCAGAGAAAAGGG + Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
991006394 5:61832374-61832396 CCCTGGACTTCCAGAGAAGATGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
992466527 5:77011726-77011748 GTCTGGGGTGGCTGAGGAGAAGG - Intergenic
993961015 5:94296557-94296579 GTCTGGGGTTGCAAAGATGATGG + Intronic
994054557 5:95400802-95400824 CTCTGAGGTTGCCCGGAAGAGGG - Intronic
996205210 5:120725939-120725961 CTCTGGAGTCTCAGAGAGGATGG - Intergenic
996299835 5:121967982-121968004 CTCTGAGGTAGAAAAGAAGATGG - Intronic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000203820 5:159038098-159038120 CTCTGGGATTGCAAAGGACAAGG - Intronic
1001940452 5:175736247-175736269 CCTTGGCCTTGCAGAGAAGAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002214285 5:177618764-177618786 ATCAGGGGTTCCAGAGAGGAGGG + Intergenic
1002306634 5:178287407-178287429 CTCTGTGAATGCAGAGATGAAGG - Intronic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003062134 6:2872139-2872161 CTCAGTGGTTGCAGATAACAAGG + Intergenic
1003120826 6:3318009-3318031 CTCTGGTGATGCAAGGAAGATGG - Intronic
1003269415 6:4593997-4594019 AGCTGGGGTGGAAGAGAAGAGGG - Intergenic
1005949731 6:30622905-30622927 CTCTGGTGGTGCAGGGATGATGG - Intronic
1005994659 6:30923929-30923951 CTCTGGGGTGGCAGTGGAGCGGG - Intronic
1006446330 6:34081775-34081797 CTCCAGGGATGCAGAGAAAAAGG + Intronic
1006735556 6:36270343-36270365 CTCCGGGGTGGCAGGGAAGCTGG + Intronic
1006991232 6:38216740-38216762 CACTGGGGTTGCCCAGAAGGTGG - Intronic
1007195788 6:40059094-40059116 TTTTGAGGTTGCAGAGAAAAGGG + Intergenic
1007724741 6:43908534-43908556 CTCTGGTTTTTCAAAGAAGATGG - Intergenic
1008183301 6:48360657-48360679 TGCTGAGGTTGCAGAGAAAAAGG + Intergenic
1010084679 6:71903160-71903182 TGGTGGGGTTGCAGAGAAAAAGG - Intronic
1010732781 6:79408883-79408905 TTCTCGGTTTGCAGAGCAGAGGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014334879 6:120120786-120120808 TGGTGGGGTTGCAGAGAAAAGGG - Intergenic
1014575063 6:123059403-123059425 CACTGGGGATTCAGAGAATAAGG - Intronic
1014910844 6:127091228-127091250 GTCTGGGATTGCAGAGAAAGGGG - Intergenic
1014982107 6:127956775-127956797 CTGGGGGGTACCAGAGAAGATGG - Intergenic
1015066468 6:129035117-129035139 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1015834623 6:137406783-137406805 TTCTGAGGTTGCAGAGAAAAGGG - Intergenic
1016055563 6:139574575-139574597 CTGGCGGGTTGCAGAGAAAAAGG - Intergenic
1017747800 6:157462242-157462264 CTCTGGGGTTTCAGAGTTGACGG + Intronic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1019178534 6:170173493-170173515 CTCTGGGGTGGCAGAGGTGGGGG - Intergenic
1019526372 7:1482240-1482262 GTCTGGGGTTGGAGAGGAGGAGG - Intronic
1020331538 7:7022339-7022361 TTGTGAGGTTGCAGAGAAAAAGG - Intergenic
1021791242 7:24208020-24208042 CACTGAGGTAGCAGAGCAGAAGG - Intergenic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1023495656 7:40793181-40793203 CTCTGGGTTTGCAGAAGAGGTGG + Intronic
1023859117 7:44206617-44206639 CTCTTGGGTTGCAGGGAAGGGGG - Intronic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026117285 7:67506574-67506596 CTATGGGGTTGCTGGGGAGAGGG + Intergenic
1027250225 7:76394014-76394036 CTCTGGGGTTGCAGCTGAGTGGG - Intronic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1027615089 7:80412716-80412738 CCCTGGGGTTTCTGAGAAGAAGG - Intronic
1027640627 7:80729350-80729372 CTCTGGATTTGCGGAGAAAAAGG + Intergenic
1027706293 7:81537336-81537358 TTCTGGGGTTTGGGAGAAGAAGG - Intergenic
1028339851 7:89705174-89705196 CACTGGGGTTGTAGAAGAGAAGG - Intergenic
1028821768 7:95219862-95219884 ATTTGGGGTTGGAGAGATGAGGG - Intronic
1029441625 7:100590009-100590031 GCTTGGGGTTGAAGAGAAGAGGG + Exonic
1030135856 7:106247225-106247247 ATTTGGGGTTCCAGAGAAGGTGG - Intergenic
1031060699 7:117048196-117048218 CTCAGGGGTGGCAGAGATGGAGG + Intronic
1031071978 7:117171976-117171998 ATCTGGGGTGACAGAGAGGAAGG - Intronic
1031401465 7:121329585-121329607 CTTCGGGGTTCCAGAGAAGCTGG + Exonic
1031448060 7:121879332-121879354 CTCTGGTGTTGGGGAGGAGAGGG + Intronic
1032079416 7:128851211-128851233 CCCTGGGGATACAGAGAAAAAGG - Exonic
1032856259 7:135836119-135836141 CTCAGGTGGTGCAGAGTAGAGGG + Intergenic
1033046736 7:137968884-137968906 CTAGGGGGTTGGAGAAAAGAAGG + Intronic
1033440320 7:141372567-141372589 CCCTGGGGTTGCAGAAGAAATGG - Intronic
1034101347 7:148453215-148453237 TACTGAGGTTGCAGAGAAAAGGG + Intergenic
1035403119 7:158581103-158581125 CTCTCTGGTTGCACAGAACAAGG - Intronic
1036509406 8:9386825-9386847 CTCTGAGATTGCAGAGATCAGGG - Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1038455686 8:27670879-27670901 ACCTGAGGTTGGAGAGAAGATGG - Exonic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1042433788 8:68740595-68740617 TGGTGGGGTTGCAGAGAAAAAGG + Intronic
1042927824 8:73984464-73984486 CTCTGGGGTTGCAGGGATGCGGG - Intergenic
1043700656 8:83284501-83284523 CTCTTGGGTAGCAGAAAACAAGG + Intergenic
1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG + Intergenic
1045301403 8:100913827-100913849 CACTGGGGTTGCAGTGAGGTGGG + Intergenic
1047064256 8:121262857-121262879 CTCTGGAGTTACAGCCAAGAGGG + Intergenic
1047157781 8:122340572-122340594 CTTTTGGGTGGCAGAGAATAAGG + Intergenic
1047762009 8:127961379-127961401 CTCTGGGGTTACAGGAAGGAAGG + Intergenic
1047825137 8:128565144-128565166 CCCTGGGGTTGGAGAGAATCTGG + Intergenic
1048148409 8:131868297-131868319 CTCTGGAGTGGCAGAGAGGCCGG - Intergenic
1048319826 8:133389744-133389766 CTCTGGAGTCGCAGAGAAGAAGG - Intergenic
1049289932 8:141796494-141796516 CACTGGGGCTGTGGAGAAGAGGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049433611 8:142576356-142576378 CTCTGGGGGTGCAGAGGGGAGGG - Intergenic
1049587574 8:143439144-143439166 CTCTGGGGTCGGGGAGCAGATGG - Intronic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1052736685 9:32349680-32349702 CTCTGATGTTCCAGAGAACATGG - Intergenic
1052865381 9:33461882-33461904 CAGTGGGGTTGCAGAGATGGGGG - Exonic
1053584846 9:39446179-39446201 CTCTGTGGTGGCAGTGAATATGG - Intergenic
1054581470 9:66919043-66919065 CTCTGTGGTGGCAGTGAATATGG + Exonic
1055160799 9:73125548-73125570 CTCAGGGGTGGCAGAGAAAGAGG + Intergenic
1055782799 9:79837683-79837705 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1056495265 9:87149272-87149294 TTCTGGGGTTCCAGAGACGCTGG + Intronic
1058945587 9:109852666-109852688 CGGTGAGGTTGCAGAGAAAAGGG - Intronic
1059521403 9:114945744-114945766 CCCTGTGGTTGGAGAGAACATGG + Intergenic
1061196172 9:129108342-129108364 CTTTGGGGTGGCAGAGGTGAGGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061776756 9:132970779-132970801 CTCTGAGGCTGCAGAGATGAAGG - Intronic
1061811566 9:133165149-133165171 CTCTGGGGGTGCAGCGGGGAGGG - Intergenic
1061955947 9:133961430-133961452 ATCTGGGGCTGCAGACCAGAGGG + Intronic
1062445162 9:136590592-136590614 CTATGGGGAGGCAGAGATGATGG - Intergenic
1185569729 X:1124339-1124361 CCCTGCGTTTGCAGCGAAGATGG - Intergenic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187764037 X:22619897-22619919 TGGTGAGGTTGCAGAGAAGAGGG + Intergenic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1188493670 X:30761298-30761320 TTGTGAGGTTGCAGAGAAAAAGG + Intergenic
1188525529 X:31083854-31083876 CTGTGTGGTTGCAGAGAAAGGGG + Intergenic
1188565747 X:31524116-31524138 CTCTGAGGTTGGGGAGAAAAAGG + Intronic
1188702871 X:33286946-33286968 CTCTGAGGTTGAAGAGATGCGGG + Intronic
1188819117 X:34751877-34751899 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1188835885 X:34953753-34953775 CTCAGGGGTTCCAGACAAGCCGG - Intergenic
1189881562 X:45498786-45498808 CGGTGAGGTTGCAGAGAAAAAGG - Intergenic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1191656644 X:63605657-63605679 CTTTGAGGTTGCAGAGAAATAGG + Intergenic
1193324340 X:80161986-80162008 TGGTGGGGTTGCAGAGAAAAAGG - Intergenic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1193550379 X:82885084-82885106 TAGTGAGGTTGCAGAGAAGAAGG + Intergenic
1194355884 X:92883441-92883463 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1194769047 X:97877921-97877943 CACTGGGGTTGCTGAGAGAATGG + Intergenic
1196573831 X:117295438-117295460 CTCTGTGTTTGCACAGAAAAAGG + Intergenic
1196768111 X:119268074-119268096 CTGGGGGGTAGCAGCGAAGATGG - Intergenic
1196989351 X:121311102-121311124 CTCTGGGTTTGCTAAGAATATGG + Intergenic
1197259219 X:124299188-124299210 TACTGGGGTTGCAGAGAAAAGGG + Intronic
1197968950 X:132094772-132094794 CACTGGTGATACAGAGAAGATGG - Intronic
1197971388 X:132118841-132118863 CTGTGGGGGAGCAGAGATGAAGG - Intronic
1198487957 X:137107299-137107321 TTCTGAGGTTGCAGAGAAAAAGG + Intergenic
1199936368 X:152577702-152577724 CTCTGTGGTCACAGAGTAGAGGG + Intergenic
1200664230 Y:6000418-6000440 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1201455567 Y:14164057-14164079 CTCTGGGGGAGCAAAGAATAGGG + Intergenic