ID: 968397196 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:251357-251379 |
Sequence | ATGTATACACACATTTGTCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
968397195_968397196 | 18 | Left | 968397195 | 4:251316-251338 | CCTAATGTGACACACACACACAC | No data | ||
Right | 968397196 | 4:251357-251379 | ATGTATACACACATTTGTCGTGG | No data | ||||
968397194_968397196 | 19 | Left | 968397194 | 4:251315-251337 | CCCTAATGTGACACACACACACA | No data | ||
Right | 968397196 | 4:251357-251379 | ATGTATACACACATTTGTCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
968397196 | Original CRISPR | ATGTATACACACATTTGTCG TGG | Intergenic | ||
No off target data available for this crispr |