ID: 968397196

View in Genome Browser
Species Human (GRCh38)
Location 4:251357-251379
Sequence ATGTATACACACATTTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968397195_968397196 18 Left 968397195 4:251316-251338 CCTAATGTGACACACACACACAC No data
Right 968397196 4:251357-251379 ATGTATACACACATTTGTCGTGG No data
968397194_968397196 19 Left 968397194 4:251315-251337 CCCTAATGTGACACACACACACA No data
Right 968397196 4:251357-251379 ATGTATACACACATTTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968397196 Original CRISPR ATGTATACACACATTTGTCG TGG Intergenic
No off target data available for this crispr