ID: 968402600

View in Genome Browser
Species Human (GRCh38)
Location 4:311589-311611
Sequence TTTGTGTTCTTGAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968402596_968402600 -4 Left 968402596 4:311570-311592 CCAATGCTCAGCCTCTCAGTTTG No data
Right 968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968402600 Original CRISPR TTTGTGTTCTTGAGGACAAA GGG Intergenic
No off target data available for this crispr