ID: 968410571

View in Genome Browser
Species Human (GRCh38)
Location 4:386527-386549
Sequence CAGGGAAGGTGCGCGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410571_968410580 -8 Left 968410571 4:386527-386549 CCCGCAGCCGCGCACCTTCCCTG No data
Right 968410580 4:386542-386564 CTTCCCTGGGCTGTGGGGTGAGG 0: 2
1: 3
2: 16
3: 105
4: 856
968410571_968410585 21 Left 968410571 4:386527-386549 CCCGCAGCCGCGCACCTTCCCTG No data
Right 968410585 4:386571-386593 TCATCTGGAAGACGCCGACGCGG No data
968410571_968410584 6 Left 968410571 4:386527-386549 CCCGCAGCCGCGCACCTTCCCTG No data
Right 968410584 4:386556-386578 GGGGTGAGGAGGAGCTCATCTGG 0: 4
1: 2
2: 3
3: 32
4: 327
968410571_968410582 -5 Left 968410571 4:386527-386549 CCCGCAGCCGCGCACCTTCCCTG No data
Right 968410582 4:386545-386567 CCCTGGGCTGTGGGGTGAGGAGG 0: 2
1: 1
2: 14
3: 121
4: 870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410571 Original CRISPR CAGGGAAGGTGCGCGGCTGC GGG (reversed) Intergenic
No off target data available for this crispr