ID: 968410706

View in Genome Browser
Species Human (GRCh38)
Location 4:387267-387289
Sequence GGAACAGGACAGGGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410706_968410716 4 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410716 4:387294-387316 GGTCTCCTCCGAGGGAGAGAGGG No data
968410706_968410712 -4 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410712 4:387286-387308 TTCCTCCAGGTCTCCTCCGAGGG No data
968410706_968410719 10 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410719 4:387300-387322 CTCCGAGGGAGAGAGGGGACTGG No data
968410706_968410717 5 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410717 4:387295-387317 GTCTCCTCCGAGGGAGAGAGGGG No data
968410706_968410722 26 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410706_968410711 -5 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410711 4:387285-387307 GTTCCTCCAGGTCTCCTCCGAGG 0: 1
1: 3
2: 0
3: 12
4: 156
968410706_968410721 21 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410706_968410715 3 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410715 4:387293-387315 AGGTCTCCTCCGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410706 Original CRISPR GGAACAGGACAGGGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr