ID: 968410708

View in Genome Browser
Species Human (GRCh38)
Location 4:387276-387298
Sequence AGACCTGGAGGAACAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410708_968410715 -6 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410715 4:387293-387315 AGGTCTCCTCCGAGGGAGAGAGG No data
968410708_968410722 17 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410708_968410719 1 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410719 4:387300-387322 CTCCGAGGGAGAGAGGGGACTGG No data
968410708_968410717 -4 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410717 4:387295-387317 GTCTCCTCCGAGGGAGAGAGGGG No data
968410708_968410716 -5 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410716 4:387294-387316 GGTCTCCTCCGAGGGAGAGAGGG No data
968410708_968410721 12 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410708 Original CRISPR AGACCTGGAGGAACAGGACA GGG (reversed) Intergenic
No off target data available for this crispr