ID: 968410710

View in Genome Browser
Species Human (GRCh38)
Location 4:387282-387304
Sequence CGGAGGAGACCTGGAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410710_968410719 -5 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410719 4:387300-387322 CTCCGAGGGAGAGAGGGGACTGG No data
968410710_968410717 -10 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410717 4:387295-387317 GTCTCCTCCGAGGGAGAGAGGGG No data
968410710_968410722 11 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410710_968410721 6 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410710 Original CRISPR CGGAGGAGACCTGGAGGAAC AGG (reversed) Intergenic
No off target data available for this crispr