ID: 968410713

View in Genome Browser
Species Human (GRCh38)
Location 4:387288-387310
Sequence CTCCCTCGGAGGAGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410713_968410722 5 Left 968410713 4:387288-387310 CCTCCAGGTCTCCTCCGAGGGAG No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410713_968410721 0 Left 968410713 4:387288-387310 CCTCCAGGTCTCCTCCGAGGGAG No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410713 Original CRISPR CTCCCTCGGAGGAGACCTGG AGG (reversed) Intergenic
No off target data available for this crispr