ID: 968410714

View in Genome Browser
Species Human (GRCh38)
Location 4:387291-387313
Sequence TCTCTCCCTCGGAGGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410714_968410721 -3 Left 968410714 4:387291-387313 CCAGGTCTCCTCCGAGGGAGAGA No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410714_968410722 2 Left 968410714 4:387291-387313 CCAGGTCTCCTCCGAGGGAGAGA No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410714 Original CRISPR TCTCTCCCTCGGAGGAGACC TGG (reversed) Intergenic
No off target data available for this crispr