ID: 968410721

View in Genome Browser
Species Human (GRCh38)
Location 4:387311-387333
Sequence AGAGGGGACTGGAAACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410706_968410721 21 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410714_968410721 -3 Left 968410714 4:387291-387313 CCAGGTCTCCTCCGAGGGAGAGA No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410713_968410721 0 Left 968410713 4:387288-387310 CCTCCAGGTCTCCTCCGAGGGAG No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410710_968410721 6 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410708_968410721 12 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data
968410709_968410721 11 Left 968410709 4:387277-387299 CCTGTCCTGTTCCTCCAGGTCTC No data
Right 968410721 4:387311-387333 AGAGGGGACTGGAAACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410721 Original CRISPR AGAGGGGACTGGAAACTTAG AGG Intergenic
No off target data available for this crispr