ID: 968410722

View in Genome Browser
Species Human (GRCh38)
Location 4:387316-387338
Sequence GGACTGGAAACTTAGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410713_968410722 5 Left 968410713 4:387288-387310 CCTCCAGGTCTCCTCCGAGGGAG No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410714_968410722 2 Left 968410714 4:387291-387313 CCAGGTCTCCTCCGAGGGAGAGA No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410718_968410722 -6 Left 968410718 4:387299-387321 CCTCCGAGGGAGAGAGGGGACTG No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410708_968410722 17 Left 968410708 4:387276-387298 CCCTGTCCTGTTCCTCCAGGTCT No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410710_968410722 11 Left 968410710 4:387282-387304 CCTGTTCCTCCAGGTCTCCTCCG No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410720_968410722 -9 Left 968410720 4:387302-387324 CCGAGGGAGAGAGGGGACTGGAA No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410706_968410722 26 Left 968410706 4:387267-387289 CCTGCTGGGCCCTGTCCTGTTCC No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data
968410709_968410722 16 Left 968410709 4:387277-387299 CCTGTCCTGTTCCTCCAGGTCTC No data
Right 968410722 4:387316-387338 GGACTGGAAACTTAGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410722 Original CRISPR GGACTGGAAACTTAGAGGAA AGG Intergenic
No off target data available for this crispr