ID: 968410987

View in Genome Browser
Species Human (GRCh38)
Location 4:389757-389779
Sequence CCAGAGAGATCCTCTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410987_968410990 15 Left 968410987 4:389757-389779 CCTCCATGAGAGGATCTCTCTGG No data
Right 968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410987 Original CRISPR CCAGAGAGATCCTCTCATGG AGG (reversed) Intergenic
No off target data available for this crispr