ID: 968410990

View in Genome Browser
Species Human (GRCh38)
Location 4:389795-389817
Sequence TGTAATCCCCAAGAATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968410989_968410990 12 Left 968410989 4:389760-389782 CCATGAGAGGATCTCTCTGGTTT No data
Right 968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG No data
968410987_968410990 15 Left 968410987 4:389757-389779 CCTCCATGAGAGGATCTCTCTGG No data
Right 968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968410990 Original CRISPR TGTAATCCCCAAGAATGCAG AGG Intergenic
No off target data available for this crispr