ID: 968412550

View in Genome Browser
Species Human (GRCh38)
Location 4:402557-402579
Sequence TTGTCTAGAGGGCTGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968412546_968412550 0 Left 968412546 4:402534-402556 CCTGCTGGAGGACTGGAAGATAG 0: 38
1: 44
2: 11
3: 14
4: 147
Right 968412550 4:402557-402579 TTGTCTAGAGGGCTGGTGTCTGG No data
968412542_968412550 21 Left 968412542 4:402513-402535 CCTGGCGAATTTCATGTCTAGCC No data
Right 968412550 4:402557-402579 TTGTCTAGAGGGCTGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968412550 Original CRISPR TTGTCTAGAGGGCTGGTGTC TGG Intergenic
No off target data available for this crispr