ID: 968413621

View in Genome Browser
Species Human (GRCh38)
Location 4:409338-409360
Sequence CTCTGCGGTTGCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968413613_968413621 22 Left 968413613 4:409293-409315 CCTGACAAAGATCTCCCATTTGT No data
Right 968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG No data
968413616_968413621 8 Left 968413616 4:409307-409329 CCCATTTGTTTGGTCCACAGGCT No data
Right 968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG No data
968413617_968413621 7 Left 968413617 4:409308-409330 CCATTTGTTTGGTCCACAGGCTG No data
Right 968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG No data
968413618_968413621 -6 Left 968413618 4:409321-409343 CCACAGGCTGAGATTACCTCTGC No data
Right 968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968413621 Original CRISPR CTCTGCGGTTGCAGAGAAGA AGG Intergenic
No off target data available for this crispr