ID: 968423888

View in Genome Browser
Species Human (GRCh38)
Location 4:508250-508272
Sequence CAGGGTGAGCAGAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968423883_968423888 -4 Left 968423883 4:508231-508253 CCTTCCCTGAAGACGTGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG 0: 1
1: 0
2: 6
3: 31
4: 341
968423887_968423888 -9 Left 968423887 4:508236-508258 CCTGAAGACGTGTGCAGGGTGAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG 0: 1
1: 0
2: 6
3: 31
4: 341
968423886_968423888 -8 Left 968423886 4:508235-508257 CCCTGAAGACGTGTGCAGGGTGA 0: 1
1: 0
2: 1
3: 4
4: 102
Right 968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG 0: 1
1: 0
2: 6
3: 31
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968423888 Original CRISPR CAGGGTGAGCAGAGACTTGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
901638939 1:10683538-10683560 CTGTGTAAGCAGAGACTTGCTGG - Intronic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
903985724 1:27226796-27226818 AAGGTTGAGCAGAGAAGTGAAGG + Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
906195418 1:43927607-43927629 CAGGGAAAACAGAGACTTGGAGG - Intronic
906667181 1:47630277-47630299 CAACATGAGCAGAGACATGAAGG + Intergenic
907272773 1:53300525-53300547 CAGGGTGGGCACAGCCTGGAAGG - Intronic
907514486 1:54984798-54984820 GAGGCTGAGCTGAGCCTTGAGGG + Intronic
907620345 1:55971661-55971683 CAATCTGAGCACAGACTTGAAGG + Intergenic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
910447531 1:87313766-87313788 CAAGGTGAGAAGAGACATTAAGG - Intergenic
910938359 1:92505665-92505687 CAGGTTGAGCAGAGACCTGGTGG + Intergenic
912220431 1:107667897-107667919 CAAGGTTGGCAGAGACTTGAGGG + Intronic
912936167 1:114005315-114005337 CAGGCTGGGCAGACACCTGAGGG + Intergenic
914249151 1:145907450-145907472 AAGGGGGAGCAGAGACCTGTGGG + Exonic
914844856 1:151277213-151277235 CATGATGAGGAGAGAGTTGATGG - Intergenic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915457292 1:156049332-156049354 CAGGCAGAGCAAAGACTTGGGGG - Intronic
915744875 1:158148159-158148181 CAGGCTGAGCAGAGGCTCAAGGG - Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916261996 1:162851453-162851475 CAGGGTGAAATGAGCCTTGAAGG - Intronic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
919848154 1:201654589-201654611 CAGGCTGAGCAGAGCCCTCAGGG + Intronic
920400907 1:205675830-205675852 CAGGGAGAGGGGATACTTGACGG - Intronic
922187894 1:223292619-223292641 CGGGGTCAGCACACACTTGAAGG + Exonic
922252709 1:223864427-223864449 CAGGGACAGCAGAGCCTGGATGG + Intergenic
922504805 1:226120363-226120385 CAGGGTGAGCTGAGGCTGGTGGG + Intergenic
922765091 1:228152408-228152430 CAGGATGAGCAGGAGCTTGATGG + Intronic
923511541 1:234657850-234657872 CAGGGTGATCTGAGACATGGTGG + Intergenic
923544589 1:234914871-234914893 ACGTGTGAGCTGAGACTTGAAGG + Intergenic
924299815 1:242625903-242625925 CAGGGTGGGCAGGAACTTCAAGG + Intergenic
924459639 1:244247620-244247642 GAGGGAGAGCAGAGACTGGGGGG + Intergenic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063267908 10:4474767-4474789 CCTGCTGAGGAGAGACTTGAGGG + Intergenic
1064097486 10:12434802-12434824 CTGGGTGTTCTGAGACTTGAAGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067045725 10:42984173-42984195 CAGTGAGGGCAGAGCCTTGATGG - Intergenic
1067967508 10:50929233-50929255 ATGTTTGAGCAGAGACTTGAGGG - Intergenic
1068293221 10:55032900-55032922 CAATGGGTGCAGAGACTTGAAGG - Intronic
1068662497 10:59637113-59637135 CAGGGAGCGGAGAGACTGGATGG - Intergenic
1069050336 10:63785881-63785903 CAGGCAGAGCAGAGAATGGATGG - Intergenic
1069534384 10:69242126-69242148 CAGGCTGAGGAGGGTCTTGAGGG - Intronic
1070310066 10:75266496-75266518 CAGCATGAGCAAAGACCTGAAGG - Intergenic
1073036063 10:100564997-100565019 CAGAGAGAGCAGACACTTGAAGG + Intergenic
1074702429 10:116104312-116104334 GAGGCTGAGCAGGGATTTGAGGG - Intronic
1074733604 10:116403907-116403929 CAGGAGGAGCACAGACTTGCCGG - Intergenic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1077473354 11:2775145-2775167 CAGGCTGAGCAGGGGTTTGATGG - Intronic
1077528811 11:3085622-3085644 CAGGGTGAGCATAATCCTGAGGG - Intergenic
1077701262 11:4444242-4444264 AAGGCAGAGCAGAGACCTGATGG + Intergenic
1078431808 11:11293889-11293911 CAGGGAGCGCAGAGTCTTGTGGG + Intronic
1078611060 11:12819983-12820005 CTGGGTGGGCAGAGACTGGGTGG + Intronic
1081194413 11:40143639-40143661 CAGGTTTAGCAGAGCCCTGAAGG - Intronic
1082675683 11:56099144-56099166 ACAGGTGAGCAAAGACTTGAAGG - Intergenic
1084051475 11:66602986-66603008 CAGGGTGAGGAGAGAACAGAAGG - Intronic
1084255852 11:67942152-67942174 CACGGTGACCACAGTCTTGAAGG + Intergenic
1084599054 11:70134047-70134069 CAGGGTGAGGAGGGTCTTGAGGG - Intronic
1084816909 11:71653175-71653197 CACGGTGACCACAGTCTTGAAGG - Intergenic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1087779875 11:102290770-102290792 CAGGACAAGCAGAGCCTTGAAGG - Intergenic
1088237564 11:107741888-107741910 CAGGCTGTGCAGAGCCTAGAAGG - Intergenic
1088622921 11:111705071-111705093 CCAGTGGAGCAGAGACTTGATGG + Exonic
1089329329 11:117678810-117678832 CAGGCTGAGCAGGGCCTTGTAGG + Intronic
1090235986 11:125147392-125147414 CAGGGTGGGAAGAGTCTTTAAGG + Intergenic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090566066 11:127993408-127993430 GAGGGTGGGCAGAGATTTCAAGG + Intergenic
1090866908 11:130709450-130709472 CTGGGGGAGCAGAGTCTTCAGGG + Intronic
1091544134 12:1489331-1489353 CAGGGTGAGCAGACACTCTTAGG + Intronic
1092288386 12:7143176-7143198 CAGGGTGAGCAGGGACTGTGAGG - Exonic
1092426090 12:8376892-8376914 CACGGTGACCACAGTCTTGAAGG + Intergenic
1095722644 12:45417455-45417477 CATGGTGAGCAAAGACCTAAGGG - Intronic
1095874774 12:47068509-47068531 CAGGCTGAGCAAAGACCTGAAGG + Intergenic
1098216044 12:68221038-68221060 CAGGGAGAGGGGAGACTTGAGGG - Intronic
1099943266 12:89215711-89215733 CAGCATGAACAGAGAGTTGACGG + Intergenic
1101208747 12:102514685-102514707 GAGGATGAGCAGGGACTTGGGGG + Intergenic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1102949491 12:117020760-117020782 GAGGGTGAGCTGCGACTTCAGGG - Intronic
1102999518 12:117374850-117374872 CAGGGTTATCAGAGCCTTAATGG - Intronic
1103706555 12:122877602-122877624 CAGTGTGAGCAGAGTCTTTGTGG - Intronic
1104721707 12:131048112-131048134 CAGGGAGAGCAGATGCTTGTCGG + Intronic
1104744456 12:131202348-131202370 CAGCGTGAACAGTGACTTGGGGG - Intergenic
1104789923 12:131474875-131474897 CAGCGTGAACAGTGACTTGGGGG + Intergenic
1106330082 13:28732145-28732167 AAGCTTGAGCAGAGACTTGCCGG + Intergenic
1106518956 13:30480024-30480046 CAGTGTGACCAGAATCTTGAAGG - Intronic
1107690404 13:42947873-42947895 GAAGGTGAGCAGAGCCCTGACGG - Intronic
1107736566 13:43405276-43405298 CAGGGTAGGCTGAAACTTGAAGG + Intronic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1110319963 13:74149937-74149959 CTGGGTGAGCAGAAACCAGAAGG - Intergenic
1110794231 13:79618612-79618634 CAGGAAGAGCTGAGTCTTGAGGG + Intergenic
1110880640 13:80568103-80568125 CAGGGTGAAGTGAGTCTTGAAGG - Intergenic
1112343439 13:98571206-98571228 CAGGGTGAGCAGTTACTGAAGGG - Intronic
1112427822 13:99319793-99319815 CTGGGTGAGCCTAGACTTGGGGG - Intronic
1113590402 13:111494942-111494964 CAGGGTGAGGAGGCACTTGGCGG + Intergenic
1113767774 13:112891693-112891715 CAGGAGGAGCAGAGACCTCAGGG - Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114227224 14:20749981-20750003 CAGGGACAGCAGATAATTGATGG - Intergenic
1115708862 14:36028054-36028076 TAGGAAGAGAAGAGACTTGAAGG - Intergenic
1115772169 14:36675884-36675906 CAGGGTGAGAAAAGAATTAATGG - Intronic
1116593948 14:46815834-46815856 AAGTCTGAGCAGAGACTTGAAGG - Intergenic
1117211584 14:53506495-53506517 CAGGATGAGCAAAGCCTTGGAGG - Intergenic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117830066 14:59741300-59741322 CAGCTTGAGCAGAGACTGAATGG - Intronic
1118385890 14:65255344-65255366 CAGGGAGAGGGGAGCCTTGAAGG - Intergenic
1118534234 14:66741772-66741794 CAGGGTGAGGAGATATTAGAAGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118820330 14:69341421-69341443 CAGGGTGAGCACAGACCATACGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119721592 14:76895134-76895156 GAGTCTGGGCAGAGACTTGATGG - Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120194442 14:81466901-81466923 AAGTCTGAGCAGAGACTTGGAGG + Intergenic
1120793664 14:88608085-88608107 CAGGGTGAGATGATACTTGCAGG - Intronic
1121798717 14:96755971-96755993 CAGGGGGAGCAGAAATCTGAGGG + Intergenic
1122286063 14:100653624-100653646 CAGGGTGAGAAGAGGCTCGCTGG - Intergenic
1122998698 14:105280225-105280247 CAGGCTGTGCAGAGACCTGGAGG + Intronic
1124367685 15:29085144-29085166 CAGGGTAACCAAATACTTGAGGG - Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127297054 15:57617867-57617889 CTTGGTGAACAGAGACTAGATGG + Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128266077 15:66267811-66267833 AAGGGTGGGCAGATATTTGAAGG - Intergenic
1128507650 15:68287401-68287423 CTGGCTGGGAAGAGACTTGAAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1130144528 15:81263785-81263807 AAGGGTGACCTGTGACTTGAAGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1132560063 16:589560-589582 CGGGGTTAGCAGAGCCGTGATGG + Intronic
1134241453 16:12509873-12509895 CAGGGAGAACAGGGACATGAGGG - Intronic
1136411986 16:30082986-30083008 GGGGGTGGTCAGAGACTTGATGG + Intronic
1136611666 16:31370286-31370308 CAGGGTGCACAGAGATTTAAAGG + Intronic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138284024 16:55794269-55794291 CAGGATGAGCAGAGTCCAGAGGG + Intergenic
1138284978 16:55802718-55802740 CAGGATGAGCAGAGTCCAGAGGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139281003 16:65770422-65770444 CAGGGTGATCAGACACCAGATGG - Intergenic
1140028144 16:71310778-71310800 CAGAGTGGGCAGAGACTAGAAGG + Intergenic
1140198656 16:72876917-72876939 CAAGGGGAACAGAGACTTGGCGG + Intronic
1140551619 16:75871939-75871961 CAGGCTGAGCCAAGACCTGAAGG - Intergenic
1141934782 16:87229972-87229994 GAAGCTGAGCAGAGTCTTGAAGG - Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143584851 17:7845967-7845989 CAGGGTGAGTGGATATTTGAAGG + Exonic
1143653092 17:8276339-8276361 CGGAGTGAGCTGAGACCTGAAGG + Intergenic
1144196463 17:12899719-12899741 CAGGATCAGGAGAGACTTTATGG + Intronic
1144640728 17:16935194-16935216 GACGGGGAGCAGAGAATTGAGGG + Intronic
1145941386 17:28744981-28745003 CAGGGCGCCCAGAAACTTGATGG - Intronic
1146482526 17:33216550-33216572 CAGGGTTTGCAAAGACTTGAAGG + Intronic
1146702633 17:34974573-34974595 CAGGGTTAGAACAGACTTAAAGG + Intronic
1147041213 17:37720796-37720818 CAAGGTGTTCAGAGACTTCAGGG + Intronic
1147056131 17:37836524-37836546 ACATGTGAGCAGAGACTTGAAGG - Intergenic
1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG + Intergenic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147773125 17:42881335-42881357 TGGGGTGAGCAGAGCCTTGGAGG + Intergenic
1148772876 17:50077060-50077082 CAGGGTGAGCAGCGCCTCGTGGG - Exonic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149995993 17:61406137-61406159 GAGGGTGAGAAGAGTCTCGATGG - Intronic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1153115725 18:1653128-1653150 CAGGGTGAGCAGGGGCTTAGTGG - Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1158756020 18:60326554-60326576 AAGGATGACAAGAGACTTGACGG - Intergenic
1160078922 18:75704254-75704276 CTGGGGGAGCAGAGACCTGGGGG + Intergenic
1160688906 19:451510-451532 AATGGAGAGCAGGGACTTGAGGG - Intronic
1161080138 19:2306508-2306530 CAGGGTAAGCCGGGACCTGAAGG - Intronic
1161331974 19:3692791-3692813 CAGGGTGTGCAGGGCCTTGTGGG - Intronic
1161513403 19:4683759-4683781 CAGGGTTAGCAGGGCCTGGAAGG - Intronic
1161849916 19:6732906-6732928 CAGGGTCTGCAGAGATTTGGGGG + Intronic
1162259228 19:9518869-9518891 CAGGGACAGCAGAGCCTGGATGG - Intergenic
1162512990 19:11131046-11131068 CAGGTTGTGCAGAGCCTTGTGGG + Intronic
1162865379 19:13541970-13541992 GACTGTGAGCAGAGACCTGAAGG + Intronic
1165092561 19:33394638-33394660 CAGGGTGGGCACCAACTTGAGGG + Intronic
1165339598 19:35201530-35201552 AAGTTTGAGCAGAGACTTAAAGG - Intergenic
1165360868 19:35336204-35336226 CCGGGTGAAGACAGACTTGATGG - Exonic
1167167838 19:47811408-47811430 TAGTGTGAGCAGAGCCTTGTGGG + Intronic
1167349642 19:48966444-48966466 CAAAGGGAGCAGAGGCTTGAGGG - Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1167780533 19:51595935-51595957 AAGTTTGAGCTGAGACTTGAAGG + Intergenic
1168081960 19:54016508-54016530 CTGGGTGGGGAGAGACTGGAGGG + Intergenic
1168451276 19:56468385-56468407 AAGGCTCATCAGAGACTTGAAGG + Intronic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926330529 2:11821776-11821798 CAGGGTGAGAGGAGTCTTGTGGG - Intronic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
927850825 2:26498257-26498279 GAAGGTGGGCAGAGGCTTGAAGG + Intronic
928443937 2:31316412-31316434 CAGAGTGTGCAGACACTTGAAGG - Intergenic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
929174018 2:38959509-38959531 AAGGGAGAGAAGAGAGTTGAAGG + Intronic
929609180 2:43257265-43257287 CAGTGGGAGCAGACACTTGAAGG - Intronic
930621566 2:53649521-53649543 CTGGTTGAGCAGAGAATTGAGGG - Intronic
932300806 2:70665697-70665719 GAGGATCAGGAGAGACTTGAAGG - Intronic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
934032218 2:88058569-88058591 CAGCATGTGCAGAGACATGAAGG - Intergenic
935216144 2:100976634-100976656 CAGGGTGTGCACAGCCTTTATGG - Intronic
936267756 2:111023418-111023440 CAGGATGAGCAGAAACCTGAGGG - Intronic
937302295 2:120850671-120850693 CAGTCAGAGCAGAGGCTTGAGGG + Intronic
937903762 2:127041695-127041717 CAGGCTGGGCAGAGACTTAAAGG - Intergenic
938229579 2:129646970-129646992 CAGAATAAGCAGAGACTTGAAGG + Intergenic
939330101 2:140747196-140747218 CAAGCAGAGCAGAGACTTCAGGG - Intronic
939688992 2:145234578-145234600 CAGGGTCAGCAGGGAAGTGAAGG + Intergenic
943951449 2:194135411-194135433 AAGGGAGAGTAGAGACATGAAGG + Intergenic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
946891723 2:224283610-224283632 CTGCGTGAGCTGAGACTTGCAGG - Intergenic
947506913 2:230714000-230714022 GATGCTGAGCAGAGTCTTGAAGG + Intronic
1168923907 20:1564412-1564434 GACATTGAGCAGAGACTTGAAGG + Exonic
1169150098 20:3282818-3282840 CCGCCTGAGCAGAGACCTGAAGG - Intronic
1169275731 20:4232619-4232641 CTTTGTGAGCAAAGACTTGAAGG - Intronic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1172275567 20:33677112-33677134 CAGGCTGAGTAGAGACTGGCTGG + Exonic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1173183292 20:40820630-40820652 CAGGGAGTGCAGTGACTGGAAGG - Intergenic
1173312831 20:41916003-41916025 GATGATGAGCAAAGACTTGAAGG + Intergenic
1174127499 20:48317714-48317736 CAGGGTGCTCAGAGACTCGTTGG + Intergenic
1174402705 20:50284413-50284435 ACGTTTGAGCAGAGACTTGAAGG - Intergenic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1175498894 20:59435417-59435439 CAGGATGAGGAGGGACTTGCCGG + Intergenic
1175899451 20:62354301-62354323 CAGGCTGATCAGAGGCCTGAGGG - Intronic
1176025753 20:62984746-62984768 CCGGGTGCACAGAGGCTTGAAGG + Intergenic
1178618246 21:34152788-34152810 CAGGGGAAGCAGAGGCTTCAAGG - Intergenic
1178928735 21:36798038-36798060 ACACGTGAGCAGAGACTTGAAGG + Intronic
1179039249 21:37787268-37787290 TAGGAAGAGCTGAGACTTGAAGG + Intronic
1182281506 22:29220186-29220208 CAGGCAGAGCAGCGACTTGCCGG - Intronic
1182295459 22:29309354-29309376 CTGGGAGAGGAGAGACTTGGGGG - Intronic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183292200 22:37009793-37009815 GAAGGTGAGCAGAGTCTTGAAGG - Intergenic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1183730394 22:39615237-39615259 TAGGGTGAGCAGACACTCGGGGG + Intronic
1183816193 22:40302758-40302780 GGGGGTGAGCAAAGACTTCAAGG + Intronic
1184067608 22:42129362-42129384 CAGGGTGGGCAGAGACGAGGTGG - Intronic
1184070346 22:42143058-42143080 CAGGGTGGGCAGAGACGAGGTGG - Intergenic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184453231 22:44595073-44595095 AAGGGAGAGAAGAGACCTGAGGG + Intergenic
1185034606 22:48465826-48465848 CATGTTAAGCAGAGACTTGGAGG + Intergenic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950750687 3:15125620-15125642 CACGGTGACCACAGTCTTGAAGG - Intergenic
952956759 3:38562463-38562485 CAGCGTCCGCAGTGACTTGATGG + Exonic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
955829380 3:62985029-62985051 AAGGGTAAGCAGAGTCCTGAGGG - Intergenic
956304078 3:67805078-67805100 CAGAGTGAGCAGAGACTGCTTGG + Intergenic
956421841 3:69094013-69094035 CTGGCTGAGCTGAGACTTGAAGG + Intronic
957070765 3:75566193-75566215 CATGGTGACCACAGTCTTGAAGG + Intergenic
959026080 3:101241356-101241378 CAGTGTGTGCAAAGACTTTAAGG + Intronic
959964216 3:112335258-112335280 CAGGGTGAGCAGATCTTTGTAGG + Intronic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
961283331 3:125780375-125780397 CACGGTGACCACAGTCTTGAAGG - Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961811604 3:129525095-129525117 GAGTGTGAGCGGAGACCTGAAGG + Intergenic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
964394716 3:156233511-156233533 CAGGTTGAGTAGAGCCTTGGAGG + Intronic
964616526 3:158672480-158672502 CCGGATGAGCAGTGACTTCAGGG + Exonic
965495303 3:169390587-169390609 AAAGGTGGGCAGAGACATGAGGG + Intronic
966344622 3:178964859-178964881 CAGGCTGAGTAGAGACGTGAGGG - Intergenic
967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG + Intronic
968232458 3:197011846-197011868 CAGGAAGAGGAGAGACTTCAGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
969739592 4:9014563-9014585 CATGGTGACCACAGTCTTGAAGG - Intergenic
969798765 4:9546096-9546118 CATGGTGACCACAGTCTTGAAGG - Intergenic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970858616 4:20676556-20676578 AAGGGTATGCAGACACTTGAGGG + Intergenic
972337421 4:38119847-38119869 CAGGCTGACCACAGACTGGAGGG + Intronic
972606923 4:40622293-40622315 GAGGCAGAGCAAAGACTTGAAGG + Intronic
973269576 4:48248525-48248547 CAAGGTGAGCAGACACTGGGAGG + Intronic
975349124 4:73326693-73326715 GAGTGTGAGCAGACTCTTGAAGG + Intergenic
975586844 4:75958698-75958720 AAGTGTGAGCAAAGTCTTGAAGG - Intronic
977706990 4:100082709-100082731 CAGAGTGTGTAGAGACCTGAAGG + Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
979903266 4:126250952-126250974 GATGGTGAGCATAGACATGAGGG - Intergenic
981245509 4:142532388-142532410 CAGAACGACCAGAGACTTGAAGG - Intronic
981462150 4:145025888-145025910 CAGTGTGAGCAGGCAGTTGATGG + Intronic
981719103 4:147780791-147780813 CAGGGTGAGCAGGTACCTAAAGG + Intronic
983010690 4:162542422-162542444 CAGGATCAGGAGAGAATTGAAGG - Intergenic
984299711 4:177899511-177899533 GAAGGTGAGCTGAGACTTGGGGG + Intronic
984342084 4:178470117-178470139 TAGAGTGAGTAGGGACTTGAGGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
988232586 5:28499946-28499968 CAAGGTCAGCAGAGATTTCAAGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990566484 5:57034754-57034776 CAGGTAGAGCAGAGACTGGTGGG - Intergenic
991492366 5:67195635-67195657 CTGGGTGAGCAGAGCCTTGTTGG - Intronic
992486930 5:77206470-77206492 ACGTTTGAGCAGAGACTTGAAGG + Intergenic
993509594 5:88754950-88754972 GATTTTGAGCAGAGACTTGAAGG - Intronic
994278870 5:97875873-97875895 CAGGTTCAGCAAAGAATTGAGGG + Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995485509 5:112636344-112636366 CATGGTGAGCTGAGACCTGTAGG - Intergenic
996485894 5:124033772-124033794 CAGGATCAGCATAGGCTTGAGGG - Intergenic
997735011 5:136206692-136206714 CAGGGGGAGTACAGACTGGAAGG + Intergenic
1000349544 5:160342578-160342600 CAGGGAGAGCAGAGTCTTCAGGG - Intronic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001287950 5:170437464-170437486 GGGGGTGAGCAGAGATTTGAAGG - Intronic
1001441795 5:171749383-171749405 GAGAATGAGCAGAGGCTTGATGG - Intergenic
1001732407 5:173970098-173970120 CAGGGAGAGCAGAGCCTGGGGGG + Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002319771 5:178368056-178368078 GTGTGTGAGCAGAGCCTTGAAGG + Intronic
1003263403 6:4545706-4545728 CAATCTGAGCAAAGACTTGAAGG - Intergenic
1003963630 6:11232656-11232678 CAGTGAGCTCAGAGACTTGAGGG - Exonic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1005901371 6:30219633-30219655 CAGGGAGAGTAGAGACATCAAGG - Intergenic
1006059868 6:31411809-31411831 CAGAGTGAGGACAGACTTGCAGG + Intronic
1007623898 6:43231585-43231607 AAGTGTGAACAAAGACTTGAAGG - Intergenic
1008138904 6:47809115-47809137 CAGGGTGAGTAAAGACTTGGGGG + Intronic
1009852437 6:69214604-69214626 TACGGTGAGCAGAGTCTTGTTGG + Intronic
1010649861 6:78440952-78440974 CAGGGAGAGTGGAGAATTGAAGG + Intergenic
1015163409 6:130177546-130177568 CAGGCTAAGCTGAGACCTGAAGG - Intronic
1015434105 6:133166029-133166051 AAAAGTGAGCAGAGATTTGAAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1015999600 6:139029340-139029362 CAGGGGGTGCAGAGTCGTGAGGG + Intronic
1016917286 6:149256046-149256068 CTGGTTGATCAGAGGCTTGAAGG - Intronic
1017716655 6:157217989-157218011 CGGGGTGAGTGGAGACCTGAGGG + Intergenic
1018610328 6:165642135-165642157 CAGCTTGTGCAGAGACCTGAAGG - Intronic
1018906345 6:168078551-168078573 GAGGGTGAGCAGAGCCGTGGGGG - Intronic
1018906354 6:168078587-168078609 GAGGGTGAGCAGAGCCGTGGGGG - Intronic
1019060809 6:169256185-169256207 CAGGGTGAGGCGGGACTTCATGG + Intergenic
1019074900 6:169379283-169379305 CAGGGAATGCAGACACTTGAAGG - Intergenic
1020227313 7:6290475-6290497 CAGGATGTCCACAGACTTGAAGG + Intergenic
1020858786 7:13461871-13461893 CAGTAAGAGCACAGACTTGAAGG - Intergenic
1021839437 7:24710454-24710476 CAGGGTCAGCCCAGCCTTGATGG + Intronic
1021905940 7:25333173-25333195 CAGGGTGAGGTGAGTCTTAAGGG - Intergenic
1022204498 7:28150255-28150277 CAGGGTGAGCAAAGATGTGCTGG + Intronic
1022651268 7:32277804-32277826 GTGGGTAAGAAGAGACTTGATGG + Intronic
1026196244 7:68176146-68176168 CCAGGTGTGCACAGACTTGAAGG - Intergenic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1029073044 7:97915495-97915517 CACGGTGACCACAGTCTTGAAGG + Intergenic
1031559877 7:123225791-123225813 CGGGGTGAGCTAAGACATGAAGG + Intergenic
1031840242 7:126728946-126728968 CTGTGTGAACAGAGACCTGAAGG - Intronic
1035360139 7:158306545-158306567 CAAACTGAGCAGAGACTTGGTGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036244634 8:7105773-7105795 CATGGTGACCACAGTCTTGAAGG - Intergenic
1036897195 8:12645659-12645681 CATGGTGACCACAGTCTTGAAGG + Intergenic
1037774590 8:21825027-21825049 CAGGGTGAGCTGAGGCTCGGAGG - Intergenic
1038258844 8:25975204-25975226 CCGGGTGAGCAGGGACTACAGGG + Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1042187271 8:66149218-66149240 TAGGTGGAGCAGAGACTTTAAGG + Intronic
1049471253 8:142775937-142775959 CAGGGTGAGCAGGGGCGTCATGG + Exonic
1049853677 8:144848579-144848601 CAGGGTGGACAGAAACTTCATGG + Intronic
1051604908 9:18909259-18909281 CAGGGTGAGCAGGGGCTTCCAGG + Exonic
1052996491 9:34554027-34554049 CAGGCTGAGCAGGAACTGGAGGG - Intronic
1053329472 9:37189934-37189956 AAGGGTGAGCACAAACTTCATGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056725343 9:89109426-89109448 AAGGGTGCTCAGAGACATGATGG + Intronic
1057303892 9:93901642-93901664 GAGGGAGGGCAGAGACTCGATGG + Intergenic
1057437737 9:95057901-95057923 TAGGGGGAGCAGATACCTGAGGG + Intronic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1060118945 9:120969788-120969810 CAGGGTGATAAGAGAATTCAAGG + Intronic
1060937278 9:127522782-127522804 CAGCTTCAGCAGAGACCTGAAGG - Intronic
1060992223 9:127855764-127855786 CAGGGGGTGCTGAGAATTGAGGG - Intergenic
1061167766 9:128934055-128934077 CACGGTGAGCAGGGGCTTGGGGG + Exonic
1061246094 9:129401869-129401891 CAGGGAGAGCAGAGCTGTGAAGG - Intergenic
1061414491 9:130438961-130438983 CTGGGTGTGTAGAGACTTCAAGG - Intergenic
1061879617 9:133562267-133562289 CAGTGTGAGCAGAGCCTGCAGGG - Intronic
1062084954 9:134643634-134643656 CAGGGTCAGGAGAGAGTTGGTGG - Intronic
1062102809 9:134737374-134737396 CGTGGGGAGCAGACACTTGAGGG + Intronic
1186273150 X:7911681-7911703 CAGGGTGAGAAAAGGCTTTAGGG - Intronic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1187364044 X:18651973-18651995 CAGGGCGGGCAGAGATCTGAAGG - Intronic
1187821296 X:23290946-23290968 CAGGTTGAGCAGAGAGTTCTAGG - Intergenic
1189349181 X:40264201-40264223 CATGGTCTGCAGAGACTGGAAGG + Intergenic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1192868119 X:75157522-75157544 CTGAGTGAACAGAGACCTGATGG + Intergenic
1192993947 X:76492501-76492523 GAGGGTGAGCAGAAACTGGGTGG + Intergenic
1195790395 X:108578288-108578310 CAGGGTGAGCAAGGTCTTCAGGG + Exonic
1195990432 X:110677026-110677048 CAGGGTGGGCAGAGACAACAGGG - Intronic
1196440273 X:115713498-115713520 CAGGGTGTGTAGTGGCTTGAAGG - Intergenic
1196577143 X:117332532-117332554 CAGGCTAAGCAGTGACTTTAAGG + Intergenic
1197709487 X:129655226-129655248 GAGGGTTTGCAGAGACCTGAAGG + Intergenic
1197988914 X:132296152-132296174 CTGGATGGTCAGAGACTTGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199472970 X:148215316-148215338 GACTATGAGCAGAGACTTGAAGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic