ID: 968426008

View in Genome Browser
Species Human (GRCh38)
Location 4:523762-523784
Sequence CTGAGCACTTCGGAGGTAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968426008_968426017 14 Left 968426008 4:523762-523784 CCCTCTACCTCCGAAGTGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 180
Right 968426017 4:523799-523821 GGATGGTGCTGGCCAGTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 155
968426008_968426018 24 Left 968426008 4:523762-523784 CCCTCTACCTCCGAAGTGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 180
Right 968426018 4:523809-523831 GGCCAGTCCGTGGCTAATACTGG 0: 1
1: 0
2: 0
3: 3
4: 29
968426008_968426014 -3 Left 968426008 4:523762-523784 CCCTCTACCTCCGAAGTGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 180
Right 968426014 4:523782-523804 CAGAGGCCGCGAGAAGTGGATGG 0: 1
1: 0
2: 0
3: 14
4: 224
968426008_968426013 -7 Left 968426008 4:523762-523784 CCCTCTACCTCCGAAGTGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 180
Right 968426013 4:523778-523800 TGCTCAGAGGCCGCGAGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
968426008_968426016 3 Left 968426008 4:523762-523784 CCCTCTACCTCCGAAGTGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 180
Right 968426016 4:523788-523810 CCGCGAGAAGTGGATGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968426008 Original CRISPR CTGAGCACTTCGGAGGTAGA GGG (reversed) Exonic
902237845 1:15068988-15069010 CTGAGAACTGCTGGGGTAGATGG - Intronic
907759450 1:57343456-57343478 CTGAGCCCTTGGGTGGTCGATGG + Intronic
908204264 1:61829014-61829036 CTGAGCACTTCCCACGTACAAGG - Intronic
914861216 1:151387861-151387883 AAAAGCACTTCGGAGGTCGAGGG + Intergenic
918002304 1:180508958-180508980 CTCAGCCCTTGGGCGGTAGATGG - Intergenic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
922247333 1:223813335-223813357 TTGAAAATTTCGGAGGTAGAGGG - Intronic
922498774 1:226081941-226081963 CTCAGCACTTTGGAGGCCGAGGG + Intergenic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
1063321002 10:5053151-5053173 CTCAGCACTTGGGTGGTTGATGG + Intronic
1063466631 10:6250150-6250172 CTGAGCCCTCAGGAGGTAAAAGG + Intergenic
1065981513 10:30902814-30902836 CTCAGCCCTTGGGTGGTAGATGG + Intronic
1066048524 10:31615272-31615294 CTGAGCTCTGGGGAGGTAGTGGG + Intergenic
1067110192 10:43395137-43395159 CAGGGCACTTGGGAGGGAGATGG + Intronic
1068031061 10:51705617-51705639 CTGAGCACTTAGTAGGGAGAAGG + Intronic
1069090751 10:64196778-64196800 CTCAGCCCTTGGGCGGTAGATGG + Intergenic
1069592493 10:69650731-69650753 CTGAGCACTTCCTTGGTTGATGG + Intergenic
1071078777 10:81784572-81784594 CTCAGCCCTTCGGCGGTTGATGG - Intergenic
1071488735 10:86121680-86121702 CTGAGCACTTAGAATGTACAAGG + Intronic
1076396648 10:130143178-130143200 ATGAGGATTTCGAAGGTAGAAGG - Intronic
1077519241 11:3021794-3021816 CAGAACAGTGCGGAGGTAGAAGG - Intronic
1080223568 11:29934490-29934512 CTCAGCCCTTGGGCGGTAGATGG - Intergenic
1081785674 11:45745213-45745235 CTGAGGACTGCCGGGGTAGAGGG + Intergenic
1088812922 11:113403603-113403625 CTGAGCAGTGTGGATGTAGAAGG - Intergenic
1090267805 11:125364508-125364530 CTGAGCTCTTGGGATGAAGAGGG - Intronic
1091597884 12:1890972-1890994 CAGACCACTTTGGAGGCAGAGGG + Intronic
1091663308 12:2400399-2400421 ATGAGAACTTGGTAGGTAGATGG - Intronic
1095052861 12:37569555-37569577 CATAGCACTTTGGAGGCAGAGGG - Intergenic
1096323120 12:50632785-50632807 CTCAGCACTTCGGGAGGAGAAGG - Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1098498696 12:71166206-71166228 CTCAGCCCTTGGGCGGTAGATGG + Intronic
1101116040 12:101532372-101532394 ATGAGCACTACGGACATAGAAGG - Intergenic
1103193161 12:119019781-119019803 TTGATCACTTGAGAGGTAGAAGG + Intronic
1103696323 12:122818507-122818529 CTGGGTACTTGGGAGGTTGAGGG + Intronic
1104728183 12:131090513-131090535 CTGCCCACTTAGGAGGAAGAGGG - Intronic
1106820908 13:33463568-33463590 CTTGGCACTTCTGAGGTAGGAGG - Intergenic
1107010931 13:35670261-35670283 CTGATCAGTTAGGAGGGAGAGGG + Intronic
1107446162 13:40471957-40471979 CTGAGCAATTCAGGGATAGAAGG - Intergenic
1110024012 13:70511917-70511939 CTCAGCCCTTGGGAGGTCGATGG + Intergenic
1110153609 13:72285728-72285750 CTGCACATTTGGGAGGTAGAGGG + Intergenic
1113472316 13:110555762-110555784 CTGAGCCCTTGGGTGGCAGATGG + Intronic
1113680341 13:112239094-112239116 CTGAGCCCTTGGGTGGTCGATGG - Intergenic
1114775029 14:25472238-25472260 CTGAGCACTTACTATGTAGAAGG - Intergenic
1115421294 14:33198745-33198767 CTGAGCCCTTGGGTGGTAGATGG + Intronic
1115638741 14:35317414-35317436 CTAACCACTTCGGTGGTAGGAGG - Exonic
1119993565 14:79227198-79227220 TTGAGCACTTCGTAGGTACCTGG + Intronic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1122101966 14:99419977-99419999 CTGAGCACCTCCGAAGTGGAAGG + Intronic
1122113565 14:99517052-99517074 CTGAGGACTTCTGAGGGAGCGGG + Intronic
1122674864 14:103404075-103404097 TTGAGAAATTCAGAGGTAGATGG + Intronic
1125243545 15:37605117-37605139 CTGATTACTCGGGAGGTAGAGGG - Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1126876380 15:53045952-53045974 CTCAGCACTTGGGAGGCTGAGGG - Intergenic
1127388068 15:58483354-58483376 CTGAGCCCCTTGGAGTTAGAAGG - Intronic
1130524126 15:84689117-84689139 CCCAGCACTTGGGAGGTTGAGGG + Intronic
1136628590 16:31476625-31476647 CTGAGGACTCCGGAGGTCGGAGG - Intronic
1139051539 16:63129987-63130009 CTCAGCCCTTGGGCGGTAGATGG - Intergenic
1139717300 16:68823793-68823815 CTGAACATTTCAGAGGTAAATGG + Intronic
1141670528 16:85489416-85489438 CTGAGAACTGCAGAGGCAGATGG - Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1145127667 17:20315366-20315388 CTGAGCACTTCTGAGGGACTGGG - Intronic
1145373382 17:22325488-22325510 CATAGCACTTTGGAGGCAGAGGG - Intergenic
1147494740 17:40904920-40904942 CTCAGCAATTCGGAGGTGAATGG + Intergenic
1148716793 17:49721721-49721743 TTGAGCACTCCTGAGGGAGAGGG + Intronic
1151438446 17:74113315-74113337 CTCAGCCCTTGGGCGGTAGATGG + Intergenic
1151531841 17:74711601-74711623 CTGGGCACGTCTGAGGAAGAGGG - Intronic
1154231369 18:12559087-12559109 CTCAGCCCTTGGGCGGTAGATGG + Intronic
1155489473 18:26385628-26385650 CTGTTCACTTCGGAAATAGAAGG - Intronic
1155806240 18:30175099-30175121 CTCAGCCCTTCGGTGGTCGATGG + Intergenic
1156367126 18:36439739-36439761 CTGAGAACCTGGGAGGTAGCTGG + Intronic
1162660571 19:12165252-12165274 GTGAGCACTATGGGGGTAGAGGG + Intronic
1164582029 19:29440367-29440389 CTCAGCCCTTGGGTGGTAGATGG - Intergenic
1166050134 19:40254280-40254302 CTCAGCACTTTGGAGGCCGAGGG + Intronic
926006529 2:9377350-9377372 CTGAGCAGTAGGGAGGTAGCAGG + Intronic
926063962 2:9822416-9822438 CTAAGAACTTCGGAGCTGGAAGG + Intergenic
926586201 2:14688313-14688335 CAGAGCACTTTGGAGTTGGAAGG + Intergenic
926666841 2:15534342-15534364 CTGAGCTCTTCTGAGCCAGATGG - Intronic
926685784 2:15696780-15696802 CTCAGCCCTTGGGAGGTCGATGG + Intronic
927749197 2:25651441-25651463 CTGATTTCTTTGGAGGTAGAAGG + Intronic
930092281 2:47539841-47539863 CTGAGCACTTCAGCTGTGGATGG - Intronic
930468172 2:51780341-51780363 CTCAGCCCTTCGGTGGTCGATGG + Intergenic
930857014 2:56029843-56029865 CTGAGCGCTTCAGAGGAAAAAGG - Intergenic
932202108 2:69838880-69838902 CTGAGTACTTAGTATGTAGAAGG - Intronic
934690823 2:96357573-96357595 CTGTGAACTCCAGAGGTAGAAGG - Intronic
934754998 2:96818629-96818651 CTGAGCAGTTCGGAGATTGAAGG + Intronic
935872783 2:107469423-107469445 CTCAGCCCTTCGGCGGTTGATGG + Intergenic
936039771 2:109141353-109141375 CTGAGCAAGTTGGAGGAAGAGGG - Intronic
938931155 2:136088075-136088097 CTCAGCCCTTGGGAGGTCGATGG + Intergenic
939054783 2:137351684-137351706 CTGATCACATAAGAGGTAGAGGG + Intronic
943720031 2:191194249-191194271 CAGAGCACTACAGAGTTAGAGGG + Intergenic
944228496 2:197370922-197370944 CTCAGCCCTTGGGTGGTAGATGG - Intergenic
945377222 2:209093323-209093345 CTGAGGACTTGTGAGGTAAAAGG - Intergenic
946127077 2:217572379-217572401 CTGAACACATAGCAGGTAGAAGG + Intronic
946493051 2:220168559-220168581 CTGAGCACTTATCATGTAGAAGG - Intergenic
946982105 2:225229454-225229476 CTCAGCCCTTGGGTGGTAGATGG + Intergenic
948954294 2:241274509-241274531 CTCAGCACTGCAGAGGGAGATGG + Intronic
948994363 2:241571062-241571084 CTGAGCACTCCTGGGGGAGATGG + Intronic
1169357147 20:4916881-4916903 CTGAGCACATGTGAGGTAGGCGG + Intronic
1170565341 20:17598846-17598868 CTCAGCACTTTAGAGGGAGAGGG - Intronic
1170989946 20:21292226-21292248 CTCAGCCCTTGGGTGGTAGATGG - Intergenic
1171529412 20:25842834-25842856 CATAGCACTTTGGAGGCAGAGGG + Intronic
1171547414 20:26013046-26013068 CATAGCACTTTGGAGGCAGAGGG - Intergenic
1175535312 20:59706898-59706920 GTGAGGACTTGAGAGGTAGAGGG - Intronic
1178208393 21:30497616-30497638 CTCAGCACTTTGGGGGTCGAGGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183303579 22:37070387-37070409 CTGAGCTCTTTGCAGATAGAGGG - Intronic
1183745044 22:39687214-39687236 CTGAGCACTTCTGAGGGGGTGGG + Exonic
949508793 3:4750827-4750849 CTGAGCACTTAGGAAGGAGAGGG - Intronic
949675368 3:6447470-6447492 CTGAGCACTTCTGAGCTGGTAGG + Intergenic
950632695 3:14293526-14293548 CTCAGCACTTGGGTGGTCGATGG - Intergenic
953124452 3:40077933-40077955 CTCAGCCCTTCGGTGGTTGATGG + Intronic
953682193 3:45047871-45047893 CTGAGAACCACTGAGGTAGAGGG + Intergenic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954804099 3:53205560-53205582 CCCAGCACTTCGGAGGGACAAGG + Intergenic
955598173 3:60614358-60614380 CCCAGCACTTTGGAGGTGGATGG + Intronic
957154618 3:76532022-76532044 CTGAGCTCTTAGTAAGTAGAAGG + Intronic
959006413 3:101025662-101025684 CTGAGGACTTCTCAGGGAGAAGG + Intergenic
959665333 3:108914608-108914630 ATGAGTACTCCGGAAGTAGATGG - Intronic
960947152 3:122974561-122974583 CTGAGGACTTCTCAGGTGGATGG + Intronic
962583503 3:136819109-136819131 CGGAGTACTGCGGAGGGAGAGGG - Exonic
964376409 3:156052325-156052347 CTCAGCCCTTGGGTGGTAGATGG - Intronic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
971904938 4:32714698-32714720 CAGAGCACTCCGGAAGTAAAAGG + Intergenic
972344701 4:38182925-38182947 CTCAGCCCTTGGGAGGTCGATGG - Intergenic
973299101 4:48559933-48559955 CTGAGCACTTGGAAGGTACCTGG + Intronic
978748626 4:112222786-112222808 CTCAGCCCTTCGGTGGTCGATGG - Intergenic
984553580 4:181188084-181188106 CTGAGCACTCTGGAAGTAGGGGG + Intergenic
985320947 4:188710664-188710686 CTGAACAATTTGGAGGCAGAAGG - Intergenic
986919085 5:12662259-12662281 CTCAGCTCTTGGGTGGTAGATGG - Intergenic
988915837 5:35892872-35892894 CTCAGCCCTTGGGTGGTAGATGG + Intergenic
990889462 5:60632644-60632666 CTGAGCACTTCGGAGGCCATGGG - Intronic
990905731 5:60801176-60801198 CTGAGCACTTCGGGAGGACAAGG - Intronic
994507175 5:100657118-100657140 CTCAGCACTTGGGTGGTTGATGG - Intergenic
994935339 5:106246566-106246588 CTCAGCCCTTCGGTGGTCGATGG - Intergenic
995132456 5:108644784-108644806 AGGAGCAGTTGGGAGGTAGAAGG + Intergenic
995988377 5:118207953-118207975 CTCAGCCCTTGGGCGGTAGATGG + Intergenic
996449193 5:123599321-123599343 CTGAGCACTTGGGAGAAAAAGGG + Intronic
1002704632 5:181152021-181152043 CTCAGCAGATCGGAGATAGACGG - Intergenic
1003302251 6:4894108-4894130 CAGAGAAGTTCAGAGGTAGAAGG + Intronic
1003862855 6:10337767-10337789 CTCAGCCCTTGGGTGGTAGATGG - Intergenic
1004016470 6:11736548-11736570 CTGAGCACAACGGAGGGTGAAGG - Intronic
1004411799 6:15387868-15387890 TTGAGGACTTCTGAGGTCGAGGG + Intronic
1004839708 6:19569125-19569147 CCCAGCACTTGGAAGGTAGAAGG - Intergenic
1005346548 6:24896141-24896163 CTCAGCACTGCTGAAGTAGAAGG - Intronic
1007422511 6:41728263-41728285 CTGAGCACATCAGAGGTACCTGG - Intronic
1008489645 6:52072806-52072828 CTGAGCATTTATAAGGTAGAAGG - Intronic
1012930013 6:105306806-105306828 CTAAGCACCTGGTAGGTAGATGG + Intronic
1013128486 6:107208543-107208565 CTGAGCACTTGGGAGGCCAAGGG - Intronic
1018250303 6:161862813-161862835 CTGACCACTTCAGAGATAGACGG - Intronic
1020015453 7:4828968-4828990 CTCAGCACTTAGGAGGATGAGGG + Intronic
1022158000 7:27679814-27679836 CTGAGCACTTGAAAGGTAGCTGG - Intergenic
1023871235 7:44264076-44264098 CTCAGCACTGGGCAGGTAGAGGG - Intronic
1023965470 7:44961443-44961465 CTGAGCACTGAGGGGGTTGAGGG + Intergenic
1024020557 7:45364185-45364207 CTGACCACATAGGAGGTAAATGG - Intergenic
1024496630 7:50055743-50055765 CTGAGCACTTATGAGGTACCAGG - Intronic
1026193118 7:68147709-68147731 CTGAGCCCTTGGGAGAGAGAAGG - Intergenic
1026596499 7:71738084-71738106 CTCAGCCCTTGGGCGGTAGATGG + Intergenic
1036717319 8:11137996-11138018 CTGATGTCTTCCGAGGTAGAAGG - Intronic
1037011282 8:13845999-13846021 CAGAGGACTTGGGAAGTAGAAGG + Intergenic
1039573640 8:38606149-38606171 ATGAGCACTGCAGAAGTAGATGG + Intergenic
1041490764 8:58430189-58430211 TTCAGCACTTCTGATGTAGAAGG - Intronic
1044075882 8:87821190-87821212 CTCAGCCCTTGGGTGGTAGATGG - Intergenic
1044389302 8:91630067-91630089 CTCAGCACTTAGAATGTAGAAGG + Intergenic
1044486268 8:92757894-92757916 CTGAGCACATTTGAGGTAGGTGG - Intergenic
1048204123 8:132401936-132401958 CTGAACACTTCTGAGTGAGAGGG + Intronic
1048221328 8:132544884-132544906 CTGTGCACTGCGGAGGTATGTGG + Intergenic
1048575984 8:135690462-135690484 CTCAGCCCTTGGGAGGTAGGTGG + Intergenic
1048655360 8:136530457-136530479 CTCAGCCCTTGGGAGGTAGATGG + Intergenic
1051056592 9:12994737-12994759 CTTACCACTTCAGTGGTAGATGG - Intergenic
1051314120 9:15810403-15810425 CTCAGCCCTTGGGAGGTAAATGG + Intronic
1051449346 9:17178417-17178439 CTCAGCCCTTGGGCGGTAGATGG + Intronic
1056216338 9:84408836-84408858 CTCAGCCCTTGGGCGGTAGATGG - Intergenic
1060594173 9:124838738-124838760 CTCAGCCCTTCGGTGGTCGATGG + Intergenic
1186056960 X:5660016-5660038 CTGAGCAATTCGTAGGCATATGG - Intergenic
1190094562 X:47468304-47468326 CAGAGCACTTTGAAGGTAGCAGG - Intronic
1191980344 X:66918036-66918058 CTGAGAACTTTGGATGCAGAAGG - Intergenic
1194173426 X:90617761-90617783 CTCAGCCCTTGGGAGGTTGATGG + Intergenic
1194204529 X:90995757-90995779 CTCAGCCCTTGGGAGGTTGATGG - Intergenic
1194748274 X:97654223-97654245 CTGAGCATCACGGGGGTAGAGGG - Intergenic
1197331120 X:125155474-125155496 CTCAGCCCTTGGGTGGTAGATGG + Intergenic
1197376741 X:125690584-125690606 CTCAGCCCTTTGGTGGTAGATGG + Intergenic
1198972534 X:142298251-142298273 CTCAGCCCTTGGGAGGTCGATGG + Intergenic
1200519646 Y:4195453-4195475 CTCAGCCCTTGGGAGGTTGATGG + Intergenic
1200550371 Y:4571198-4571220 CTCAGCCCTTGGGAGGTTGATGG - Intergenic
1201373189 Y:13287486-13287508 CTAACCACTTCGGTGGTAGGAGG - Intronic
1202202374 Y:22367152-22367174 CTCAGCCCTTGGGCGGTAGATGG + Intronic