ID: 968426288

View in Genome Browser
Species Human (GRCh38)
Location 4:525788-525810
Sequence TTTCCAGAGAAGCCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968426283_968426288 12 Left 968426283 4:525753-525775 CCTTCTATCTGCCTGCTGTGTGC 0: 1
1: 0
2: 1
3: 29
4: 314
Right 968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 154
968426285_968426288 -10 Left 968426285 4:525775-525797 CCTGCACGTTTCCTTTCCAGAGA 0: 1
1: 0
2: 0
3: 12
4: 134
Right 968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 154
968426284_968426288 1 Left 968426284 4:525764-525786 CCTGCTGTGTGCCTGCACGTTTC 0: 1
1: 0
2: 0
3: 15
4: 157
Right 968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968426288 Original CRISPR TTTCCAGAGAAGCCCCGGAG AGG Intronic
901475578 1:9487032-9487054 TTGACAGAGAAGATCCGGAGAGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
901970610 1:12904776-12904798 TCTCCAGAGATGCCCCAGAAAGG + Intronic
902014555 1:13296994-13297016 TCTCCAGAGATGCCCCAGAAAGG - Intergenic
902610140 1:17592383-17592405 TATCCAGAAAAGCCCAGGAAGGG - Intronic
902990689 1:20185556-20185578 TTCCCAGTGTGGCCCCGGAGTGG + Intergenic
903523782 1:23976639-23976661 TTTCGAGGGTAGCCCCAGAGAGG - Intronic
903652758 1:24931368-24931390 TTTGCAGTGAAGCCCAGGAGAGG - Intronic
904570485 1:31460490-31460512 TTTCCAGCCAAGACCTGGAGTGG + Intergenic
904772195 1:32886605-32886627 ATTCCCGGGAAGCCCGGGAGCGG - Intronic
907075288 1:51572684-51572706 TTTTCAGAGGAGCCTCAGAGAGG - Intergenic
907826607 1:58023242-58023264 TTTCCAGAGAGGCTCTGGAAAGG - Intronic
910480339 1:87651926-87651948 CTTCCAGGGAAGCCTGGGAGAGG + Intergenic
912234580 1:107835501-107835523 TTCCCAGACCAGCCCCGCAGAGG - Intronic
912817134 1:112838223-112838245 TTTCCAGAAAGACCCAGGAGTGG - Intergenic
914316281 1:146515004-146515026 TTCACAGTGAAGCCCCAGAGGGG + Intergenic
914498074 1:148218357-148218379 TTCACAGTGAAGCCCCAGAGGGG - Intergenic
916731095 1:167567434-167567456 TGGCCAGAGAAGCCCTGCAGTGG - Intergenic
920110209 1:203582325-203582347 TCTCCAGAGAAGCCCCCCAAGGG - Intergenic
921500351 1:215894950-215894972 TACCCAGAGAAGACCAGGAGAGG - Intronic
922570858 1:226634068-226634090 TTGCCTGAGCAGCCCTGGAGAGG + Exonic
923136309 1:231123199-231123221 TTCCCAGTGAAGGCCTGGAGGGG - Intergenic
1067738828 10:48880055-48880077 ATTCCAGAGAAGCCCCCAGGAGG - Intronic
1070322645 10:75365948-75365970 TTCCCAGAGGAGCCCCAGTGAGG + Intergenic
1070687609 10:78500765-78500787 GTACCAGTGAAGCCCAGGAGCGG + Intergenic
1072636848 10:97183864-97183886 TGTCCAGAGGACCCCCGCAGTGG - Intronic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1076991824 11:279669-279691 TTCCCGGAGAAGCCCCGGCGCGG + Intronic
1078339082 11:10486243-10486265 TGCCCAGACAAGCCCCAGAGTGG - Intronic
1078742046 11:14075829-14075851 TCTCCAGAGAAGCCCAGCAGGGG + Intronic
1078999392 11:16738642-16738664 GTGGCAGAGAAGGCCCGGAGGGG + Exonic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1080758897 11:35228753-35228775 TGTGCAGAGAAGCCCCTGAGGGG + Intronic
1083087580 11:60166198-60166220 TTTCCCTAGAAGCTCCAGAGAGG + Intergenic
1083581249 11:63826931-63826953 TGTCCCGCGGAGCCCCGGAGGGG - Exonic
1084458865 11:69285214-69285236 TGTCCAGAGAGGCCCCGTGGCGG - Intergenic
1085058607 11:73424297-73424319 TTTCCTGAGCAGCCCAGGTGAGG + Intronic
1085749867 11:79152347-79152369 TTTACAGAGGAGAACCGGAGAGG + Intronic
1087116254 11:94528231-94528253 CTTCCACTGAAGCCCCTGAGGGG + Intergenic
1088105444 11:106202058-106202080 TTTCCAGAGAAGCCTCAGGCAGG - Intergenic
1088992155 11:114963045-114963067 TGTCCAGAGAAGCCTCAAAGAGG + Intergenic
1089737372 11:120559111-120559133 TTTCTTGAGAAGCCCAGGAGTGG + Intronic
1091074448 11:132602157-132602179 TTTCCACAGAAGCCTCCCAGAGG + Intronic
1092160643 12:6313568-6313590 TTTCCCCAGAAACCCCAGAGAGG - Intronic
1100267468 12:92991119-92991141 TTTCCAGAGCATCACCTGAGTGG + Intergenic
1102584387 12:113912834-113912856 TGTCCAGGGAAGCCCCAGACAGG - Intronic
1103303582 12:119946642-119946664 TTTCCAGGAATGCCCAGGAGAGG + Intergenic
1103869486 12:124081117-124081139 CCTCCAGAGAAGGCCCTGAGTGG + Intronic
1110142671 13:72149946-72149968 TTGGCAGAGAAGCCCTGGATGGG + Intergenic
1117525410 14:56597420-56597442 TTTGCAAAGAAACCCCGAAGTGG + Intronic
1119899958 14:78251104-78251126 TGTCCAGCGAAGCTCCGGTGTGG - Intronic
1120353364 14:83393682-83393704 TTTCCAGAGAACCACCAGACAGG - Intergenic
1120452036 14:84680823-84680845 TGTCAAGAGAAGCCACGGTGTGG - Intergenic
1122767564 14:104082482-104082504 TGGCCAGAGCAGCCACGGAGTGG - Intergenic
1127569009 15:60222508-60222530 TTTGCAGATAAGCCTCTGAGTGG - Intergenic
1127982831 15:64046741-64046763 TTTCCAGATAAGGCCGGGGGAGG - Intronic
1128226295 15:66003693-66003715 TTTACAAAGAAGCCATGGAGAGG - Intronic
1129297161 15:74605950-74605972 TTTACAGATAAGGCCCAGAGAGG + Intronic
1129508877 15:76105340-76105362 GTTCCAGGGAAGCCTCAGAGGGG - Intronic
1132024812 15:98396193-98396215 GTTCCAGAGAAGCCCTTGAAAGG - Intergenic
1139436864 16:66941508-66941530 TTTCAAGATGATCCCCGGAGTGG + Exonic
1139472040 16:67183640-67183662 TGCGGAGAGAAGCCCCGGAGAGG + Exonic
1141277512 16:82601999-82602021 TTTCCAGAGATACCCATGAGAGG - Intergenic
1141424130 16:83934529-83934551 GGCCCAGAGAAGCCCCGCAGCGG - Intronic
1141989916 16:87603648-87603670 CTTCCAGGGAAGCCCGGGAAAGG - Intronic
1143911462 17:10253320-10253342 TTTCCAGGGAAGACCCAGAAAGG + Intergenic
1144838413 17:18170837-18170859 TTTACAGATAAGGCCCAGAGAGG + Intronic
1147266577 17:39238004-39238026 TCTCCAGAGGAGCCCGGGAATGG - Intergenic
1148036583 17:44667733-44667755 TTTCAAGCCAAGCCCCAGAGTGG + Exonic
1150128425 17:62653313-62653335 TTCCCAGAGAACCCCAGGGGCGG + Intronic
1150712562 17:67544376-67544398 TTCCCACTGAAGCCCAGGAGGGG + Intronic
1150827986 17:68493483-68493505 TTTGCAGCCAAGCCTCGGAGTGG + Intergenic
1151763981 17:76122647-76122669 TTTGGAGAGGAGCCTCGGAGGGG + Intergenic
1152316982 17:79586739-79586761 TCTCCAGAGAAACCCGGGAGAGG - Intergenic
1152469401 17:80482521-80482543 TTTCCAGAGCATCCACTGAGGGG + Intergenic
1152491487 17:80637506-80637528 TTTTCAGAGAAGCAGGGGAGAGG + Intronic
1154228658 18:12533091-12533113 TTTCCAGAGAAGACTGGGAAAGG + Intronic
1154369247 18:13743604-13743626 TTTCCAGAGTTTCCCCGGTGGGG + Intronic
1155147338 18:23094971-23094993 TTTCCAGGGAACCCGAGGAGGGG + Intergenic
1157286634 18:46381500-46381522 TTTCCAGAGAAGCCTCCTGGAGG + Intronic
1159010244 18:63052199-63052221 TTTCCAGATAATCCCAGAAGTGG - Intergenic
1160226646 18:77017102-77017124 TTTCCCGAGATGCCCCGGGGAGG - Exonic
1161067007 19:2243587-2243609 TTTCCAGGGCAGCCCTGGAGAGG + Intronic
1165200458 19:34139496-34139518 GTTCAAGAGAAGGCCGGGAGCGG - Intergenic
1168121455 19:54254480-54254502 TTTCCAGAGAAGCCACGGGCAGG - Intronic
1168288171 19:55344718-55344740 TGTCCAGACATGCCCAGGAGAGG + Intronic
927954722 2:27200536-27200558 TTTCCTGAGAAGCCGAGGAATGG - Exonic
929000778 2:37345038-37345060 TCTCCAGAACAGCCCCGGACTGG - Intronic
930872584 2:56184020-56184042 TTTCCGGAGCAGCCTAGGAGCGG + Intergenic
931968639 2:67561540-67561562 TTTCCAGACAAGCTCTGGACTGG - Intergenic
933901765 2:86855230-86855252 TTTCCAGAGGAGGCTCAGAGAGG - Intronic
935778783 2:106494033-106494055 TTTCCAGAGGAGGCTCAGAGAGG + Intergenic
937112610 2:119378194-119378216 TTTCCAAAGAAGCTCTGGGGAGG + Intergenic
941081648 2:161068297-161068319 TTCCCAGAGCAGCACAGGAGGGG - Intergenic
942644190 2:178093132-178093154 TCTACAGAGAAGCCAAGGAGTGG - Intronic
945959280 2:216115220-216115242 TATCCAGAGAAACTCCGGAGTGG - Intronic
946149838 2:217756781-217756803 ATTCCAGAGAAGCCCCTTTGAGG - Intergenic
948394245 2:237632692-237632714 TTTCCAGAACAGCCCAGAAGTGG + Intronic
948430153 2:237913616-237913638 TTTCCTGAGAGGCCCCAGTGAGG + Intergenic
948437168 2:237961535-237961557 CTTCCAGGAAAGCCCTGGAGGGG - Intergenic
948809318 2:240466733-240466755 CCTCCAGAGAAGCCCCGCACGGG + Exonic
1169344224 20:4817638-4817660 TCTCCAGAGGAGGCCTGGAGAGG - Intronic
1170204733 20:13785533-13785555 CCTCCAGTGAAGCTCCGGAGAGG + Intronic
1170405142 20:16027919-16027941 ATTCCAGCCAAGCCCTGGAGGGG + Intronic
1172274258 20:33671200-33671222 TTCACAGAGAAGCCACGGGGAGG + Intronic
1172321109 20:33995465-33995487 TTTTCAGATAAGGCCCAGAGTGG + Intronic
1172611236 20:36254080-36254102 TTTGCACAGAAACCCAGGAGTGG - Intronic
1172903159 20:38349539-38349561 TTTCCACAGCGGCCCAGGAGGGG + Exonic
1173591004 20:44224814-44224836 TTTGCAGATGAGCCCCAGAGAGG + Intergenic
1174139122 20:48400514-48400536 TTGCCAGAGCAGCCACAGAGGGG - Intergenic
1174528260 20:51190857-51190879 TATCCAGAGAAGCAGAGGAGGGG + Intergenic
1174528278 20:51190938-51190960 TATCCAGAGAAGCGGAGGAGGGG + Intergenic
950487099 3:13280406-13280428 TTTGCTGAGCAGCCCCGGGGGGG + Intergenic
953716373 3:45319848-45319870 TTTCCAGAGCAGCCCCCATGAGG - Intergenic
954431245 3:50471984-50472006 TGTCCAGAGAAGCACAGAAGTGG + Intronic
956746381 3:72314246-72314268 TTTCCAGAAAAGCCCCCAAATGG - Intergenic
960054427 3:113266987-113267009 TTTCCAGTGGAGACCCAGAGAGG - Intronic
961026023 3:123558284-123558306 TTTTAAGACAAGCCCCAGAGTGG + Intronic
961743277 3:129046963-129046985 TTTCCGGAGGGGCCCCGGAGCGG - Intergenic
963099612 3:141587419-141587441 TTTCCACAGAAGGCCAGGTGTGG + Intronic
963669798 3:148236907-148236929 TTTGAAGAGAAGCCCCAGACTGG + Intergenic
964722798 3:159783969-159783991 TTTAGAAAGAAGCCCCGGGGTGG - Intronic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
967137884 3:186528022-186528044 TTGTCAGAGAAGCCCCTGAGGGG + Intergenic
967219074 3:187234273-187234295 CAGCCAGAGAAGCCCCTGAGAGG - Exonic
967312979 3:188123618-188123640 TTTACTGGGAAGCCCCAGAGAGG + Intergenic
968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG + Intronic
968487134 4:868118-868140 TTTCCTGAAAAGCCTCAGAGGGG + Intronic
969473956 4:7410455-7410477 TTTACAGAGGAGACCCAGAGAGG - Intronic
969615060 4:8247409-8247431 TTTCCAGAGAAGTCTGAGAGGGG + Intergenic
970191893 4:13525265-13525287 TTTCCAGAGTAGCCTCAGAGAGG + Intergenic
973240906 4:47954764-47954786 TTTCCAGGGAATCCCTGAAGGGG - Intronic
978119346 4:105059842-105059864 TTTCTGGAGAGGCCCAGGAGAGG + Intergenic
988349534 5:30084320-30084342 CTTCCACAGAAGCCACGGAGAGG + Intergenic
989325321 5:40186578-40186600 TCTCCAAAGAAGCCACAGAGCGG - Intergenic
992506322 5:77390767-77390789 TTTACAGTGAAGCCCCAGAAGGG - Intronic
992675554 5:79102404-79102426 TTTCAAGAAAAGACCTGGAGCGG + Intronic
1002023039 5:176377404-176377426 TTTCCAGAGATGCCCCATAAAGG + Exonic
1005405003 6:25477219-25477241 TTTCCAAATAAGTCCCTGAGTGG - Intronic
1005838009 6:29722676-29722698 TTTCCAGAGAAGAAGAGGAGGGG + Intergenic
1006924760 6:37648265-37648287 GTTCCAGAGAAGCTGCTGAGGGG + Intronic
1007796274 6:44350522-44350544 TGTCCTGAGAAGCCCCAGAGTGG + Intronic
1007959167 6:45942976-45942998 TTTCCAGAGAAGCAGTGGAGGGG - Intronic
1008597045 6:53052779-53052801 TTTCCAGAGAAGCTCCAAATAGG - Intronic
1015039681 6:128702224-128702246 TTTCCAGAGTAGACCAGCAGTGG - Intergenic
1018031570 6:159845515-159845537 TTTCCAGAGCAGCCCAGGCAGGG - Intergenic
1019627088 7:2021864-2021886 TCTCCAGAGAATCCCATGAGAGG + Intronic
1021326823 7:19281226-19281248 TTTCCAAATAAGGCCCAGAGAGG - Intergenic
1024030223 7:45454415-45454437 TTGCCAGAGAAGACCCAGTGTGG + Intergenic
1024572223 7:50732750-50732772 ATTCCAAAGAAGCCCAGAAGGGG + Intronic
1024985270 7:55188600-55188622 TTTCCTGAGAGGCCCCGCTGAGG + Intronic
1029180969 7:98701537-98701559 CTTACAGAGAATCCCCTGAGAGG - Intergenic
1030981279 7:116187472-116187494 CTTCCAGAGAACCACCAGAGAGG - Intergenic
1034589315 7:152126695-152126717 TTTCCTGAGAAGCCCCCATGTGG - Intergenic
1036219285 8:6907780-6907802 TTTGCAGAGGAGGCCCAGAGAGG + Intergenic
1041779335 8:61560266-61560288 TTGCAAGAGAATCCCAGGAGGGG + Intronic
1044563500 8:93637856-93637878 TTTCCAGAAACACCCTGGAGAGG + Intergenic
1051140378 9:13972407-13972429 TTTACAGATAAGGCCTGGAGAGG - Intergenic
1054887845 9:70218402-70218424 TTTCCAGAGACTCCTCGCAGAGG - Exonic
1055242864 9:74205268-74205290 TTTCCAAAGCAGCCCAGCAGGGG - Intergenic
1055371680 9:75606493-75606515 TTCCCAGGGAAGCCCCAGGGTGG - Intergenic
1056102344 9:83311808-83311830 TTGCCCGAGAAGCCAAGGAGGGG + Intronic
1056149571 9:83771790-83771812 TTTCCACAGAAGCTCAGCAGTGG - Intronic
1057074981 9:92133956-92133978 TTTCTTGAGAGGCCCCTGAGAGG - Intergenic
1057168649 9:92947610-92947632 CTTCCAGAGGAGCCCCGGGGAGG - Exonic
1057211277 9:93202406-93202428 TTCCCACGGAAGCGCCGGAGGGG - Intronic
1057424998 9:94941179-94941201 TTTACAGAGAAGAGCCAGAGGGG - Intronic
1058185369 9:101848378-101848400 TTTCCAAAGAAACCCCAGAAAGG - Intergenic
1061667071 9:132166786-132166808 GGCCCAGAGAAGCCCTGGAGAGG - Exonic
1186961685 X:14743536-14743558 GTTACATAGAAGCCCTGGAGGGG - Intergenic
1189168802 X:38888992-38889014 TTTGCAGATAAGCCTCTGAGTGG - Intergenic
1195246718 X:103001784-103001806 TTCCCAGCAAAGCCCGGGAGAGG - Intergenic