ID: 968428105

View in Genome Browser
Species Human (GRCh38)
Location 4:536221-536243
Sequence CGCCTATCACTGCTGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968428105_968428106 -5 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428106 4:536239-536261 AGGCGCGTGCCTTCCCACAGCGG 0: 1
1: 0
2: 0
3: 5
4: 85
968428105_968428112 15 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428112 4:536259-536281 CGGACATGGAGCCTTTCCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 79
968428105_968428107 1 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428107 4:536245-536267 GTGCCTTCCCACAGCGGACATGG 0: 1
1: 0
2: 0
3: 7
4: 125
968428105_968428111 14 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428111 4:536258-536280 GCGGACATGGAGCCTTTCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 105
968428105_968428113 16 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428113 4:536260-536282 GGACATGGAGCCTTTCCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968428105 Original CRISPR CGCCTATCACTGCTGAAGCA AGG (reversed) Intronic