ID: 968428105

View in Genome Browser
Species Human (GRCh38)
Location 4:536221-536243
Sequence CGCCTATCACTGCTGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968428105_968428111 14 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428111 4:536258-536280 GCGGACATGGAGCCTTTCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 105
968428105_968428106 -5 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428106 4:536239-536261 AGGCGCGTGCCTTCCCACAGCGG 0: 1
1: 0
2: 0
3: 5
4: 85
968428105_968428112 15 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428112 4:536259-536281 CGGACATGGAGCCTTTCCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 79
968428105_968428113 16 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428113 4:536260-536282 GGACATGGAGCCTTTCCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
968428105_968428107 1 Left 968428105 4:536221-536243 CCTTGCTTCAGCAGTGATAGGCG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 968428107 4:536245-536267 GTGCCTTCCCACAGCGGACATGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968428105 Original CRISPR CGCCTATCACTGCTGAAGCA AGG (reversed) Intronic
901815455 1:11791055-11791077 CCCATGTCACTGCTGATGCAGGG - Intronic
903781988 1:25826604-25826626 CGCGTATCACTCCTGGACCAGGG - Exonic
907036202 1:51218556-51218578 AGCCTAACACTGCTGAAGTTGGG + Intergenic
912013623 1:105004728-105004750 GGCATGTCACTGCTGCAGCAGGG + Intergenic
1063077566 10:2732137-2732159 CACCAACCACTGCTGAGGCATGG + Intergenic
1069768296 10:70880322-70880344 CGACTACCACTGCTGGTGCAAGG - Exonic
1073165658 10:101447369-101447391 TGCCTATCACTGCTGTACAAAGG - Intronic
1076851059 10:133093237-133093259 CACCTCTCACTGCTGCAGAAAGG + Intronic
1085315488 11:75542377-75542399 CGACTTTCACTGCTAAAACAGGG - Intergenic
1085754731 11:79193040-79193062 GGCCTCTCACTGCTCAGGCAGGG - Intronic
1090161251 11:124497927-124497949 CGCTTTTCCCTGCTGAAGCTGGG - Intergenic
1091560649 12:1610350-1610372 CTGCTTTCACTGCTGAAGTAGGG + Intronic
1092585779 12:9899639-9899661 CGGCTTTCACCCCTGAAGCAGGG + Intronic
1109622950 13:64932904-64932926 CGCAAATCACAGCTGAAGAAGGG - Intergenic
1111513606 13:89298110-89298132 AGCATGTGACTGCTGAAGCATGG + Intergenic
1117966651 14:61213377-61213399 CTCCTCTCCCTGCTGAGGCATGG - Intronic
1121021896 14:90585298-90585320 CGCCTGTCACTGCTGCAGCTAGG - Intronic
1124504507 15:30261530-30261552 CGCCTGGCGCTGCTGAGGCAGGG + Intergenic
1124636743 15:31370253-31370275 CTCCTGGTACTGCTGAAGCAGGG - Intronic
1124739044 15:32277105-32277127 CGCCTGGCGCTGCTGAGGCAGGG - Intergenic
1125766541 15:42140466-42140488 AACCTCTCACTGCTGAACCAAGG + Exonic
1126180402 15:45779728-45779750 CACCTATCCCTGGTAAAGCAGGG + Intergenic
1126437908 15:48654565-48654587 CGTTTCTCACTGCTGAATCAAGG - Intergenic
1128692587 15:69736423-69736445 AGCCTAACACTGCAGAAGGAAGG + Intergenic
1130965072 15:88691078-88691100 TGCCTATCACTGGGGAACCATGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1134484876 16:14649815-14649837 CGTCTATCACTGGAGCAGCAGGG + Exonic
1138840965 16:60505543-60505565 CCACCATCACTGCTGAAACAAGG - Intergenic
1142242095 16:88952242-88952264 CGTCTATCATTGCTGGAGCCAGG + Intronic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1152747910 17:82049668-82049690 CGCCTGTACCTGCTGGAGCAGGG + Exonic
1153917355 18:9758022-9758044 CGCACATCCCTTCTGAAGCACGG + Intronic
1157796191 18:50577863-50577885 CTCCTATCACTGCAGATACAAGG - Intronic
1164756431 19:30693249-30693271 CCCTTATCCCTGCTGAAGGAAGG + Intronic
1166104241 19:40589611-40589633 CCCCTTTCCCAGCTGAAGCAAGG - Intronic
1167225023 19:48232271-48232293 AGCCTGTCACTGCTGGGGCATGG - Intronic
1168332657 19:55579160-55579182 CGCCCACCACCGCTGCAGCAGGG - Exonic
926933944 2:18068055-18068077 AGCCTATGAGAGCTGAAGCATGG + Intronic
929115246 2:38438476-38438498 CACCTATAACTGTTGGAGCAGGG - Intergenic
941691058 2:168501218-168501240 CACCTACCCCTGCTGAATCATGG - Intronic
946735138 2:222746538-222746560 AGCCTGGCACTGCTGAAGAAAGG + Intergenic
953682174 3:45047787-45047809 TGGCTATCACAGCTGAAGCAGGG - Intergenic
955237049 3:57148885-57148907 ATCCTATCACTGCAGAAGAATGG + Intronic
955508664 3:59657770-59657792 CTCCTTCCACTGCTGAACCAAGG - Intergenic
968428105 4:536221-536243 CGCCTATCACTGCTGAAGCAAGG - Intronic
970366106 4:15359825-15359847 CTCCTTTCCCTTCTGAAGCATGG + Intronic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
975739421 4:77414753-77414775 CGCCTATCACAGCTGGACCATGG + Intronic
977561552 4:98538076-98538098 CCCCTATTGCTGCTGATGCAGGG - Intronic
979468978 4:121072547-121072569 CGAGTGTCACTGCTGAAGCCCGG + Intronic
980638643 4:135542458-135542480 TGCATATCACTGCAGAGGCAGGG + Intergenic
983591381 4:169415685-169415707 GGCCTATCCCTGCTGATGAATGG + Intronic
989084309 5:37658690-37658712 CACCTAGCACTTCTGAAGCTGGG - Intronic
994408224 5:99372944-99372966 GGCCTATCTATGCTGTAGCATGG - Intergenic
1006621545 6:35368245-35368267 TGGCTATCACTGCTGAAGCTTGG - Intronic
1007164862 6:39822050-39822072 GGCCTGTTACTGCTGAAGCCTGG + Intronic
1018919099 6:168158655-168158677 CTCCTATCATTGCCGGAGCATGG + Intergenic
1024738228 7:52328500-52328522 CGCCTACCATTGCTGAGGCTTGG - Intergenic
1025148711 7:56527595-56527617 CTTCTATCACTGCAGAACCAGGG - Intergenic
1034092587 7:148377811-148377833 CGCATATCACTTTTGAACCATGG - Intronic
1035306869 7:157938892-157938914 CTCATATCAGTGCTGAAGTAAGG + Intronic
1040446288 8:47498200-47498222 GGCCTATCACTGCCAAAACAAGG - Intronic
1043479017 8:80633970-80633992 TGCCTACCAGTTCTGAAGCAAGG + Exonic
1047240488 8:123083238-123083260 CGCCAAGCACTGTTGACGCAGGG + Intronic
1056859787 9:90170405-90170427 CTCCTCTCACTGCTTAGGCAGGG + Intergenic
1199472924 X:148214726-148214748 CGCCTATCAGTGATGATGAAAGG + Intergenic