ID: 968429356

View in Genome Browser
Species Human (GRCh38)
Location 4:546276-546298
Sequence GGGCACCACAACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968429356_968429357 -4 Left 968429356 4:546276-546298 CCAGCACAGTGGTTGTGGTGCCC No data
Right 968429357 4:546295-546317 GCCCGTTTTCAAATGTTCATCGG No data
968429356_968429360 8 Left 968429356 4:546276-546298 CCAGCACAGTGGTTGTGGTGCCC No data
Right 968429360 4:546307-546329 ATGTTCATCGGACCACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968429356 Original CRISPR GGGCACCACAACCACTGTGC TGG (reversed) Intergenic
No off target data available for this crispr