ID: 968430347

View in Genome Browser
Species Human (GRCh38)
Location 4:554801-554823
Sequence AGGCCTTGAAAGGCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430347_968430360 23 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430347_968430354 4 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data
968430347_968430350 -8 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data
968430347_968430353 3 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data
968430347_968430359 22 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430359 4:554846-554868 CTGGGCAATTCTGGTAGCACTGG No data
968430347_968430357 13 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430347 Original CRISPR AGGCCTTGAAAGGCTCAGTG AGG (reversed) Intergenic
No off target data available for this crispr