ID: 968430349

View in Genome Browser
Species Human (GRCh38)
Location 4:554811-554833
Sequence GTGCCAGGAAAGGCCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430349_968430361 22 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430349_968430359 12 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430359 4:554846-554868 CTGGGCAATTCTGGTAGCACTGG No data
968430349_968430357 3 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430349_968430353 -7 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data
968430349_968430360 13 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430349_968430354 -6 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430349 Original CRISPR GTGCCAGGAAAGGCCTTGAA AGG (reversed) Intergenic
No off target data available for this crispr