ID: 968430350

View in Genome Browser
Species Human (GRCh38)
Location 4:554816-554838
Sequence CAAGGCCTTTCCTGGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430343_968430350 29 Left 968430343 4:554764-554786 CCAGGTCTCATATATTAGACTCA No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data
968430342_968430350 30 Left 968430342 4:554763-554785 CCCAGGTCTCATATATTAGACTC No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data
968430347_968430350 -8 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data
968430345_968430350 -5 Left 968430345 4:554798-554820 CCGCCTCACTGAGCCTTTCAAGG No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data
968430344_968430350 -4 Left 968430344 4:554797-554819 CCCGCCTCACTGAGCCTTTCAAG No data
Right 968430350 4:554816-554838 CAAGGCCTTTCCTGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430350 Original CRISPR CAAGGCCTTTCCTGGCACCC TGG Intergenic
No off target data available for this crispr