ID: 968430351

View in Genome Browser
Species Human (GRCh38)
Location 4:554821-554843
Sequence AATTTCCAGGGTGCCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430351_968430360 3 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430351_968430359 2 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430359 4:554846-554868 CTGGGCAATTCTGGTAGCACTGG No data
968430351_968430357 -7 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430351_968430361 12 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430351 Original CRISPR AATTTCCAGGGTGCCAGGAA AGG (reversed) Intergenic
No off target data available for this crispr