ID: 968430352

View in Genome Browser
Species Human (GRCh38)
Location 4:554826-554848
Sequence CAGGCAATTTCCAGGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430352_968430362 27 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430362 4:554876-554898 AGGTGATCTGCCTATTTCCTAGG No data
968430352_968430360 -2 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430352_968430363 28 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data
968430352_968430361 7 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430352_968430359 -3 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430359 4:554846-554868 CTGGGCAATTCTGGTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430352 Original CRISPR CAGGCAATTTCCAGGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr