ID: 968430353

View in Genome Browser
Species Human (GRCh38)
Location 4:554827-554849
Sequence CTGGCACCCTGGAAATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430347_968430353 3 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data
968430349_968430353 -7 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data
968430344_968430353 7 Left 968430344 4:554797-554819 CCCGCCTCACTGAGCCTTTCAAG No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data
968430345_968430353 6 Left 968430345 4:554798-554820 CCGCCTCACTGAGCCTTTCAAGG No data
Right 968430353 4:554827-554849 CTGGCACCCTGGAAATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430353 Original CRISPR CTGGCACCCTGGAAATTGCC TGG Intergenic
No off target data available for this crispr