ID: 968430354

View in Genome Browser
Species Human (GRCh38)
Location 4:554828-554850
Sequence TGGCACCCTGGAAATTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430345_968430354 7 Left 968430345 4:554798-554820 CCGCCTCACTGAGCCTTTCAAGG No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data
968430344_968430354 8 Left 968430344 4:554797-554819 CCCGCCTCACTGAGCCTTTCAAG No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data
968430349_968430354 -6 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data
968430347_968430354 4 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430354 4:554828-554850 TGGCACCCTGGAAATTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430354 Original CRISPR TGGCACCCTGGAAATTGCCT GGG Intergenic
No off target data available for this crispr