ID: 968430356

View in Genome Browser
Species Human (GRCh38)
Location 4:554834-554856
Sequence GAATTGCCCAGGCAATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430356_968430361 -1 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430356_968430362 19 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430362 4:554876-554898 AGGTGATCTGCCTATTTCCTAGG No data
968430356_968430360 -10 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430356_968430363 20 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430356 Original CRISPR GAATTGCCCAGGCAATTTCC AGG (reversed) Intergenic
No off target data available for this crispr