ID: 968430357

View in Genome Browser
Species Human (GRCh38)
Location 4:554837-554859
Sequence GGAAATTGCCTGGGCAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430344_968430357 17 Left 968430344 4:554797-554819 CCCGCCTCACTGAGCCTTTCAAG No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430351_968430357 -7 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430349_968430357 3 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430347_968430357 13 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data
968430345_968430357 16 Left 968430345 4:554798-554820 CCGCCTCACTGAGCCTTTCAAGG No data
Right 968430357 4:554837-554859 GGAAATTGCCTGGGCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430357 Original CRISPR GGAAATTGCCTGGGCAATTC TGG Intergenic
No off target data available for this crispr