ID: 968430360

View in Genome Browser
Species Human (GRCh38)
Location 4:554847-554869
Sequence TGGGCAATTCTGGTAGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430345_968430360 26 Left 968430345 4:554798-554820 CCGCCTCACTGAGCCTTTCAAGG No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430355_968430360 -9 Left 968430355 4:554833-554855 CCCTGGAAATTGCCTGGGCAATT No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430351_968430360 3 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430347_968430360 23 Left 968430347 4:554801-554823 CCTCACTGAGCCTTTCAAGGCCT No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430344_968430360 27 Left 968430344 4:554797-554819 CCCGCCTCACTGAGCCTTTCAAG No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430356_968430360 -10 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430349_968430360 13 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data
968430352_968430360 -2 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430360 4:554847-554869 TGGGCAATTCTGGTAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430360 Original CRISPR TGGGCAATTCTGGTAGCACT GGG Intergenic
No off target data available for this crispr