ID: 968430361

View in Genome Browser
Species Human (GRCh38)
Location 4:554856-554878
Sequence CTGGTAGCACTGGGCAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430352_968430361 7 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430356_968430361 -1 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430355_968430361 0 Left 968430355 4:554833-554855 CCCTGGAAATTGCCTGGGCAATT No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430349_968430361 22 Left 968430349 4:554811-554833 CCTTTCAAGGCCTTTCCTGGCAC No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data
968430351_968430361 12 Left 968430351 4:554821-554843 CCTTTCCTGGCACCCTGGAAATT No data
Right 968430361 4:554856-554878 CTGGTAGCACTGGGCAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430361 Original CRISPR CTGGTAGCACTGGGCAGTAC AGG Intergenic
No off target data available for this crispr