ID: 968430363

View in Genome Browser
Species Human (GRCh38)
Location 4:554877-554899
Sequence GGTGATCTGCCTATTTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968430358_968430363 9 Left 968430358 4:554845-554867 CCTGGGCAATTCTGGTAGCACTG No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data
968430352_968430363 28 Left 968430352 4:554826-554848 CCTGGCACCCTGGAAATTGCCTG No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data
968430355_968430363 21 Left 968430355 4:554833-554855 CCCTGGAAATTGCCTGGGCAATT No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data
968430356_968430363 20 Left 968430356 4:554834-554856 CCTGGAAATTGCCTGGGCAATTC No data
Right 968430363 4:554877-554899 GGTGATCTGCCTATTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968430363 Original CRISPR GGTGATCTGCCTATTTCCTA GGG Intergenic
No off target data available for this crispr