ID: 968434055

View in Genome Browser
Species Human (GRCh38)
Location 4:576026-576048
Sequence AGAGCGCGGCGCAGGCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968434047_968434055 23 Left 968434047 4:575980-576002 CCGACGGCGGCGGCGCTGAGCGC No data
Right 968434055 4:576026-576048 AGAGCGCGGCGCAGGCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968434055 Original CRISPR AGAGCGCGGCGCAGGCCCCG CGG Intergenic
No off target data available for this crispr