ID: 968434153

View in Genome Browser
Species Human (GRCh38)
Location 4:576323-576345
Sequence CCTCCTGGGAGGGGCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968434153_968434167 11 Left 968434153 4:576323-576345 CCCGCGGGGCCCCTCCCAGGAGG No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968434153 Original CRISPR CCTCCTGGGAGGGGCCCCGC GGG (reversed) Intergenic
No off target data available for this crispr