ID: 968434167

View in Genome Browser
Species Human (GRCh38)
Location 4:576357-576379
Sequence CCAACCCCCCACCCCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968434158_968434167 0 Left 968434158 4:576334-576356 CCTCCCAGGAGGCTCGTTCCCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434153_968434167 11 Left 968434153 4:576323-576345 CCCGCGGGGCCCCTCCCAGGAGG No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434159_968434167 -3 Left 968434159 4:576337-576359 CCCAGGAGGCTCGTTCCCCCCCA No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434160_968434167 -4 Left 968434160 4:576338-576360 CCAGGAGGCTCGTTCCCCCCCAA No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434148_968434167 20 Left 968434148 4:576314-576336 CCTCCCCAGCCCGCGGGGCCCCT No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434156_968434167 2 Left 968434156 4:576332-576354 CCCCTCCCAGGAGGCTCGTTCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434146_968434167 22 Left 968434146 4:576312-576334 CCCCTCCCCAGCCCGCGGGGCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434150_968434167 16 Left 968434150 4:576318-576340 CCCAGCCCGCGGGGCCCCTCCCA No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434145_968434167 23 Left 968434145 4:576311-576333 CCCCCTCCCCAGCCCGCGGGGCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434155_968434167 10 Left 968434155 4:576324-576346 CCGCGGGGCCCCTCCCAGGAGGC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434147_968434167 21 Left 968434147 4:576313-576335 CCCTCCCCAGCCCGCGGGGCCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434149_968434167 17 Left 968434149 4:576317-576339 CCCCAGCCCGCGGGGCCCCTCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434151_968434167 15 Left 968434151 4:576319-576341 CCAGCCCGCGGGGCCCCTCCCAG No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data
968434157_968434167 1 Left 968434157 4:576333-576355 CCCTCCCAGGAGGCTCGTTCCCC No data
Right 968434167 4:576357-576379 CCAACCCCCCACCCCGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968434167 Original CRISPR CCAACCCCCCACCCCGCCCG CGG Intergenic
No off target data available for this crispr