ID: 968434559

View in Genome Browser
Species Human (GRCh38)
Location 4:577617-577639
Sequence CCAGTTCGTTTCTGCTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968434544_968434559 24 Left 968434544 4:577570-577592 CCGGAAGGCCCTCGGCCGAGCAG No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data
968434552_968434559 -10 Left 968434552 4:577604-577626 CCCCTGGTCCCTTCCAGTTCGTT No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data
968434548_968434559 15 Left 968434548 4:577579-577601 CCTCGGCCGAGCAGCTGGGCCTG No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data
968434547_968434559 16 Left 968434547 4:577578-577600 CCCTCGGCCGAGCAGCTGGGCCT No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data
968434549_968434559 9 Left 968434549 4:577585-577607 CCGAGCAGCTGGGCCTGCACCCC No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data
968434551_968434559 -4 Left 968434551 4:577598-577620 CCTGCACCCCTGGTCCCTTCCAG No data
Right 968434559 4:577617-577639 CCAGTTCGTTTCTGCTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968434559 Original CRISPR CCAGTTCGTTTCTGCTGCGG CGG Intergenic