ID: 968436120

View in Genome Browser
Species Human (GRCh38)
Location 4:590426-590448
Sequence ATTTTGGCCTGGAGGTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968436120_968436130 20 Left 968436120 4:590426-590448 CCCTTGCACCTCCAGGCCAAAAT No data
Right 968436130 4:590469-590491 TGATCTCATCTGAGGCACAAGGG No data
968436120_968436128 12 Left 968436120 4:590426-590448 CCCTTGCACCTCCAGGCCAAAAT No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436120_968436129 19 Left 968436120 4:590426-590448 CCCTTGCACCTCCAGGCCAAAAT No data
Right 968436129 4:590468-590490 GTGATCTCATCTGAGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968436120 Original CRISPR ATTTTGGCCTGGAGGTGCAA GGG (reversed) Intergenic
No off target data available for this crispr