ID: 968436128

View in Genome Browser
Species Human (GRCh38)
Location 4:590461-590483
Sequence CAGAGCTGTGATCTCATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968436119_968436128 13 Left 968436119 4:590425-590447 CCCCTTGCACCTCCAGGCCAAAA No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436120_968436128 12 Left 968436120 4:590426-590448 CCCTTGCACCTCCAGGCCAAAAT No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436117_968436128 19 Left 968436117 4:590419-590441 CCTCTGCCCCTTGCACCTCCAGG No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436121_968436128 11 Left 968436121 4:590427-590449 CCTTGCACCTCCAGGCCAAAATT No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436124_968436128 1 Left 968436124 4:590437-590459 CCAGGCCAAAATTAAGGCGTCGC No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436125_968436128 -4 Left 968436125 4:590442-590464 CCAAAATTAAGGCGTCGCCCAGA No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data
968436123_968436128 4 Left 968436123 4:590434-590456 CCTCCAGGCCAAAATTAAGGCGT No data
Right 968436128 4:590461-590483 CAGAGCTGTGATCTCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968436128 Original CRISPR CAGAGCTGTGATCTCATCTG AGG Intergenic
No off target data available for this crispr