ID: 968437090

View in Genome Browser
Species Human (GRCh38)
Location 4:599279-599301
Sequence CCTCTGGAAGCTCTGTCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968437083_968437090 21 Left 968437083 4:599235-599257 CCTGGAGGTATCTGAGAAACAGC No data
Right 968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG No data
968437082_968437090 26 Left 968437082 4:599230-599252 CCATACCTGGAGGTATCTGAGAA No data
Right 968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG No data
968437081_968437090 27 Left 968437081 4:599229-599251 CCCATACCTGGAGGTATCTGAGA No data
Right 968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968437090 Original CRISPR CCTCTGGAAGCTCTGTCCTC GGG Intergenic
No off target data available for this crispr