ID: 968438415

View in Genome Browser
Species Human (GRCh38)
Location 4:608337-608359
Sequence GGTTTAGAAGACTCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438415_968438421 17 Left 968438415 4:608337-608359 CCACAGGCAGAGTCTTCTAAACC No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data
968438415_968438420 12 Left 968438415 4:608337-608359 CCACAGGCAGAGTCTTCTAAACC No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data
968438415_968438416 -10 Left 968438415 4:608337-608359 CCACAGGCAGAGTCTTCTAAACC No data
Right 968438416 4:608350-608372 CTTCTAAACCCTCCACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438415 Original CRISPR GGTTTAGAAGACTCTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr