ID: 968438417

View in Genome Browser
Species Human (GRCh38)
Location 4:608358-608380
Sequence TGCAGACTCCAGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438417_968438423 27 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data
968438417_968438420 -9 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data
968438417_968438422 13 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438422 4:608394-608416 GTCTGGCTTGTTTCTCTGTGAGG No data
968438417_968438424 28 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data
968438417_968438421 -4 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438417 Original CRISPR TGCAGACTCCAGACTGTGGA GGG (reversed) Intergenic