ID: 968438418

View in Genome Browser
Species Human (GRCh38)
Location 4:608359-608381
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438418_968438422 12 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438422 4:608394-608416 GTCTGGCTTGTTTCTCTGTGAGG No data
968438418_968438424 27 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data
968438418_968438420 -10 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data
968438418_968438421 -5 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data
968438418_968438423 26 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438418 Original CRISPR TTGCAGACTCCAGACTGTGG AGG (reversed) Intergenic