ID: 968438419

View in Genome Browser
Species Human (GRCh38)
Location 4:608362-608384
Sequence CGCTTGCAGACTCCAGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438419_968438423 23 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data
968438419_968438422 9 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438422 4:608394-608416 GTCTGGCTTGTTTCTCTGTGAGG No data
968438419_968438424 24 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data
968438419_968438421 -8 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438419 Original CRISPR CGCTTGCAGACTCCAGACTG TGG (reversed) Intergenic