ID: 968438420

View in Genome Browser
Species Human (GRCh38)
Location 4:608372-608394
Sequence GAGTCTGCAAGCGAGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438418_968438420 -10 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data
968438415_968438420 12 Left 968438415 4:608337-608359 CCACAGGCAGAGTCTTCTAAACC No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data
968438417_968438420 -9 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438420 Original CRISPR GAGTCTGCAAGCGAGTGCTG AGG Intergenic
No off target data available for this crispr