ID: 968438421

View in Genome Browser
Species Human (GRCh38)
Location 4:608377-608399
Sequence TGCAAGCGAGTGCTGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438418_968438421 -5 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data
968438415_968438421 17 Left 968438415 4:608337-608359 CCACAGGCAGAGTCTTCTAAACC No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data
968438417_968438421 -4 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data
968438419_968438421 -8 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438421 4:608377-608399 TGCAAGCGAGTGCTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438421 Original CRISPR TGCAAGCGAGTGCTGAGGTC TGG Intergenic