ID: 968438423

View in Genome Browser
Species Human (GRCh38)
Location 4:608408-608430
Sequence TCTGTGAGGCAGACGCTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438418_968438423 26 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data
968438417_968438423 27 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data
968438419_968438423 23 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438423 4:608408-608430 TCTGTGAGGCAGACGCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968438423 Original CRISPR TCTGTGAGGCAGACGCTGCT CGG Intergenic
No off target data available for this crispr