ID: 968438424

View in Genome Browser
Species Human (GRCh38)
Location 4:608409-608431
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968438418_968438424 27 Left 968438418 4:608359-608381 CCTCCACAGTCTGGAGTCTGCAA No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data
968438417_968438424 28 Left 968438417 4:608358-608380 CCCTCCACAGTCTGGAGTCTGCA No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data
968438419_968438424 24 Left 968438419 4:608362-608384 CCACAGTCTGGAGTCTGCAAGCG No data
Right 968438424 4:608409-608431 CTGTGAGGCAGACGCTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type