ID: 968441335

View in Genome Browser
Species Human (GRCh38)
Location 4:626009-626031
Sequence GTCCAGTGGGAAGACGATCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968441335_968441347 29 Left 968441335 4:626009-626031 CCGAGATCGTCTTCCCACTGGAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968441347 4:626061-626083 CAAAAAGATGGTGAACGTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
968441335_968441345 17 Left 968441335 4:626009-626031 CCGAGATCGTCTTCCCACTGGAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968441345 4:626049-626071 CGTGGCTCAGACCAAAAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 126
968441335_968441340 -10 Left 968441335 4:626009-626031 CCGAGATCGTCTTCCCACTGGAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968441340 4:626022-626044 CCCACTGGACATCGGGGTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 44
968441335_968441342 -9 Left 968441335 4:626009-626031 CCGAGATCGTCTTCCCACTGGAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968441342 4:626023-626045 CCACTGGACATCGGGGTCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 41
968441335_968441343 -1 Left 968441335 4:626009-626031 CCGAGATCGTCTTCCCACTGGAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 968441343 4:626031-626053 CATCGGGGTCGTGGGCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968441335 Original CRISPR GTCCAGTGGGAAGACGATCT CGG (reversed) Exonic
900909363 1:5584021-5584043 GTGCAGTGGCACGGCGATCTCGG - Intergenic
901805914 1:11738437-11738459 GTCTTGTGGGAAGAAGACCTTGG + Intronic
903545570 1:24121480-24121502 GGACAGTGGGGAGAGGATCTGGG + Exonic
904378833 1:30097666-30097688 GTCCAGTGGAAAGAGGTTGTGGG + Intergenic
906209077 1:44002375-44002397 GCCCAGTGAGTAGAAGATCTGGG + Exonic
906669805 1:47646152-47646174 GTCCAGTGGAAAGAAGGTCTGGG - Intergenic
918569996 1:185978925-185978947 GTACTTTGGGAAGACGATGTGGG - Intronic
919697850 1:200596947-200596969 GTACAGTGGCATGATGATCTCGG + Intronic
923428524 1:233896286-233896308 GTGCAGTGGCACGATGATCTCGG + Intergenic
1064407133 10:15074068-15074090 GTCCACTGGGGGGACGATCCAGG - Intergenic
1065066258 10:21968559-21968581 GTGCAGTGGCACGACGATCTCGG + Intronic
1069788470 10:71004713-71004735 AGCCAGTGGGCAGAGGATCTGGG - Intergenic
1070595934 10:77833272-77833294 GTCCATTTGGAAGACCATTTGGG - Intronic
1072608912 10:97003955-97003977 GCCAAGTGGGAAGATGATCCTGG - Intronic
1074147117 10:110726500-110726522 ATCCAGTGGGTAGAGGAACTGGG - Intronic
1080703660 11:34667807-34667829 GCCCAGAGGGAAGATGATGTTGG - Intergenic
1081941169 11:46943559-46943581 GTCCAGTGGCAAGAAGAAATTGG - Intronic
1084487314 11:69456285-69456307 GTCCAGAGGGAAGATCCTCTAGG + Intergenic
1084907189 11:72357262-72357284 GGCCAATGAGAAGATGATCTGGG + Intronic
1087874300 11:103337399-103337421 GTCCAGTGCCAAGACCAGCTTGG - Intronic
1089928574 11:122285272-122285294 GTCCAGTGGAGAGTCCATCTAGG + Intergenic
1091686736 12:2567722-2567744 GCCCAGTGGGGACATGATCTTGG - Exonic
1092629355 12:10361912-10361934 ATCCAGTGGGAAAACATTCTGGG - Intergenic
1094178303 12:27564619-27564641 GGCCAGAGGGAAGATGAACTTGG - Intronic
1095648426 12:44577526-44577548 GTGCAGTGGCACGATGATCTCGG + Intronic
1095649304 12:44588115-44588137 GTGCAGTGGCACGATGATCTCGG - Intronic
1098421868 12:70306204-70306226 GTGCAGTGGCATGATGATCTTGG + Intronic
1102244295 12:111345390-111345412 GTGCAGTGGGGGCACGATCTCGG - Intronic
1102244394 12:111346052-111346074 GTGCAGTGGGGGCACGATCTCGG - Intronic
1103331243 12:120155491-120155513 CTCCAGTGGGAAGAAGGGCTGGG - Intronic
1104221615 12:126790004-126790026 GTTCAATGGGAAGAAGCTCTAGG + Intergenic
1104607989 12:130203904-130203926 CTGAAGTGGGAAGAGGATCTGGG + Intergenic
1106205436 13:27589216-27589238 TTCCAGTAGGAAGAGGCTCTGGG - Intronic
1108057512 13:46499206-46499228 GTCCAGTAGGAAGCTGAGCTTGG + Intergenic
1109349643 13:61161845-61161867 GTCCTATGGCAAGAAGATCTTGG + Intergenic
1111359955 13:87163092-87163114 GTGCAGTGGCATGATGATCTCGG - Intergenic
1112170850 13:96970472-96970494 GTCCAGTGGGAACAGCAGCTAGG - Intergenic
1115996320 14:39199472-39199494 GTGCAATGGGGCGACGATCTCGG + Intergenic
1117803831 14:59469769-59469791 GTCTAGGGGGAAAATGATCTTGG + Intronic
1120906076 14:89622489-89622511 GTCCAGCGTGAGGACGTTCTTGG + Intergenic
1121605575 14:95237598-95237620 GTGCAGAGGGAAGAAGACCTTGG + Intronic
1122703848 14:103608059-103608081 GTCCAAGGGAAAGGCGATCTGGG - Intronic
1126478437 15:49091483-49091505 GCCCAGTGGGAAGTAGATATTGG - Intergenic
1127906156 15:63377923-63377945 TTCCAGTGGGAATATGATATTGG - Intronic
1140544915 16:75798264-75798286 TTGCAGTGGGATGACAATCTTGG + Intergenic
1142115775 16:88355430-88355452 GTCCAGCGGGAAGATGAACATGG - Intergenic
1147904383 17:43813453-43813475 CTCCAGTGGGCAGAGGATCCTGG - Intronic
1150166814 17:62951771-62951793 GTGCAGTGGCATGATGATCTTGG + Intergenic
1150824301 17:68461118-68461140 TTCCAGTGGGAATAAGATTTTGG + Intergenic
1155531895 18:26775733-26775755 GGCCAGTGGGAAGCCTGTCTTGG - Intergenic
1158204839 18:54981192-54981214 GTCATGTGAGAAGAGGATCTGGG + Intergenic
1158721993 18:59933361-59933383 GTGCAGTGGCACGATGATCTCGG + Intergenic
1159212026 18:65336258-65336280 GTGCAGTGGCATGATGATCTTGG + Intergenic
1161819167 19:6518703-6518725 GTGCAGTGGCATGATGATCTCGG + Intergenic
1161881432 19:6956695-6956717 CTCCAGAGGAAAGACGATGTGGG + Intergenic
1163596313 19:18223091-18223113 GTGCAGTGGGGGAACGATCTCGG + Intronic
1163952596 19:20603787-20603809 GTGCAGTGGCACGAGGATCTCGG - Intronic
1164048369 19:21562546-21562568 GTGCAGTGGCATGATGATCTCGG - Intergenic
1164386638 19:27776851-27776873 GCCAAGTGGGAAGACCACCTGGG - Intergenic
1165957708 19:39512070-39512092 GTGCAGTGGCACGATGATCTTGG + Intergenic
927689724 2:25199655-25199677 GTGCAGTGGCACGATGATCTCGG - Intergenic
928075541 2:28261378-28261400 GTGCAGTGGCACGAGGATCTTGG + Intronic
930534574 2:52630220-52630242 GGCCATGGGGAAGCCGATCTAGG - Intergenic
932551765 2:72777188-72777210 GTGCAGTGGCATGAGGATCTTGG - Intronic
934133966 2:88977082-88977104 GTGCAGTGGTATGATGATCTCGG - Intergenic
935432051 2:102986777-102986799 TTCCACTGGGAAGATGATCATGG + Intergenic
939166366 2:138645310-138645332 GTCCAGTAGAAAGAGGATCGAGG + Intergenic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
947217664 2:227764110-227764132 GTGCAGTGGCACGATGATCTCGG + Intergenic
947531330 2:230910405-230910427 CTCCAGCGGGAAGAAGACCTTGG + Exonic
1172546738 20:35767738-35767760 GTGCAGTGGCATGATGATCTTGG + Intergenic
1172698471 20:36838099-36838121 GTGCAGTGGTGACACGATCTTGG + Intronic
1175973407 20:62698580-62698602 GTCCAGTGGGCAGAAGACCAGGG - Intergenic
1181032026 22:20152919-20152941 GTCCTGTGGGAAAACGCCCTCGG - Intergenic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1184533867 22:45073231-45073253 GTCCAGAGGGGAGACAATCCAGG - Intergenic
950184464 3:10936707-10936729 GTCCAGAGGGAAGCTGACCTGGG + Intronic
951114001 3:18838508-18838530 GACCAGTGGGCAAAAGATCTTGG - Intergenic
951580696 3:24159782-24159804 GTCCAGTGGGAAGAGGGACCAGG + Intronic
952344111 3:32468200-32468222 GTCCAGTGGCGGCACGATCTCGG + Intronic
953538146 3:43791422-43791444 GAACAGTGGGAAGACAAGCTGGG - Intergenic
953769796 3:45771393-45771415 GCCAAGTGAGAAGAAGATCTGGG + Exonic
953890445 3:46748434-46748456 GTCTAGAGGAAAGAGGATCTTGG - Intronic
954811223 3:53249529-53249551 GTGCAGTGGGGCGGCGATCTTGG - Intronic
957208926 3:77235826-77235848 GTCTAGGGGGAAGAGGATATGGG - Intronic
963093172 3:141505961-141505983 GTATAGTGGGAAGATGTTCTTGG + Intronic
963963570 3:151338753-151338775 GAGCAGTGGGAAGAGGACCTGGG + Exonic
964727113 3:159824973-159824995 GGCCAGTAGGAAGACAAACTGGG - Intronic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
968151562 3:196340966-196340988 GTGCAGTGCCACGACGATCTTGG + Intergenic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
968928303 4:3561804-3561826 TTTCAGTGGGAAGCCGATCAAGG - Intergenic
969615455 4:8250146-8250168 GTACAGTGGCCAGACCATCTAGG - Intergenic
971757800 4:30723125-30723147 GTCCAGCGAGTAGGCGATCTCGG - Exonic
974406342 4:61476276-61476298 GTGCAGCGGGTGGACGATCTCGG + Intronic
980834391 4:138173241-138173263 GTCCAGATGAAAGACTATCTGGG - Intronic
988083350 5:26441305-26441327 GTCTAGTGGGAAGACAAACATGG + Intergenic
992168827 5:74082115-74082137 GTACAGTGGGATGACTGTCTGGG - Intergenic
992310479 5:75493591-75493613 GACCACTGGGAAGAAGATCTTGG - Intronic
1000883183 5:166720580-166720602 GTCCAGAGGAAACACGGTCTAGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003493779 6:6646277-6646299 GTCCAGGGGTCAGACTATCTGGG - Intronic
1003880989 6:10479407-10479429 GTGCAGTGGCCAGATGATCTTGG - Intergenic
1009416478 6:63421369-63421391 GTGCAGTGGCATGATGATCTTGG - Intergenic
1012915216 6:105162677-105162699 GTGCAGTGGTAAGATGATCTCGG - Intronic
1012940246 6:105407831-105407853 GTCCAGTGCCAAGCCGATTTAGG + Intergenic
1019460696 7:1156851-1156873 GGGCAGTGGGAAGACAAGCTGGG + Intronic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1023414280 7:39917658-39917680 AACCAGTGGGAAGGAGATCTGGG - Intergenic
1029375062 7:100172134-100172156 GTCCATTGGGGTGAAGATCTCGG - Exonic
1032357416 7:131223637-131223659 GCCCTGTGGGAAGAAGATCCAGG - Intronic
1039901522 8:41756194-41756216 GTGTAGTGGCACGACGATCTCGG + Intronic
1044688735 8:94855196-94855218 GTCCAGTGGGAACATAATGTAGG + Intronic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1047497444 8:125418717-125418739 GTGCAGTGGCATGATGATCTCGG + Intergenic
1048256314 8:132907503-132907525 GTGCAGTGGGAAGGGCATCTGGG + Intronic
1051583094 9:18698332-18698354 GTGCAGTGGCATGATGATCTCGG + Intronic
1058055444 9:100444119-100444141 GTCCTGTAGGCAGACGATCCTGG + Intronic
1061182621 9:129034039-129034061 GTGCAATGGCATGACGATCTTGG + Intergenic
1188391083 X:29620506-29620528 GTCAAGTGGGAAGAGGAAATGGG - Intronic
1190126754 X:47712285-47712307 GCCCTTTGGGAAGACGACCTTGG + Intergenic
1195232294 X:102861777-102861799 GTTCAGTGGGAAGCAAATCTGGG - Intergenic
1195380450 X:104265868-104265890 GTGCAGTGGCACGATGATCTGGG + Intergenic
1195476286 X:105289459-105289481 GTCCAGAGGGAAGATGATTATGG + Intronic
1196769673 X:119281287-119281309 GTGCAGTGGTATGATGATCTCGG - Intergenic
1196830413 X:119771516-119771538 GTGCAGTGGCGTGACGATCTTGG + Intergenic
1197726156 X:129777745-129777767 GGCCAGTGGGAAGGAGATCTGGG + Intergenic
1201666424 Y:16461667-16461689 GTGCAGTGGCATGATGATCTCGG - Intergenic