ID: 968443101

View in Genome Browser
Species Human (GRCh38)
Location 4:634367-634389
Sequence CTCACGCACCTGCCGCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968443101_968443108 -5 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443108 4:634385-634407 GTGAGGTGCCAGGCAGGGCGGGG 0: 1
1: 0
2: 5
3: 64
4: 558
968443101_968443116 25 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443116 4:634415-634437 TGAGGCCTGTCCAAGTCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 140
968443101_968443110 7 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443110 4:634397-634419 GCAGGGCGGGGCCCCCCATGAGG 0: 1
1: 0
2: 0
3: 17
4: 232
968443101_968443107 -6 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443107 4:634384-634406 CGTGAGGTGCCAGGCAGGGCGGG 0: 1
1: 1
2: 3
3: 46
4: 623
968443101_968443105 -10 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443105 4:634380-634402 GGTGCGTGAGGTGCCAGGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 279
968443101_968443106 -7 Left 968443101 4:634367-634389 CCGGAGGGCGGCAGGTGCGTGAG 0: 1
1: 0
2: 5
3: 21
4: 207
Right 968443106 4:634383-634405 GCGTGAGGTGCCAGGCAGGGCGG 0: 1
1: 0
2: 3
3: 49
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968443101 Original CRISPR CTCACGCACCTGCCGCCCTC CGG (reversed) Intronic
900124553 1:1063737-1063759 GTCCTGCACCTGCCTCCCTCAGG + Intergenic
900345729 1:2209511-2209533 CTCACCCACCCAGCGCCCTCAGG + Intronic
900389718 1:2428698-2428720 CTCAGGAACCTGCCGGTCTCCGG + Intronic
901188595 1:7390310-7390332 CTCAGGGACCTGCTGTCCTCAGG + Intronic
901540175 1:9910362-9910384 CCCACGCGCCCGCCTCCCTCCGG - Intergenic
904378840 1:30097693-30097715 CTCCTGCAGCTGCTGCCCTCTGG - Intergenic
904625249 1:31798662-31798684 CCCACCCAGCTGCCTCCCTCTGG - Intronic
904717744 1:32481752-32481774 CTCTCCCACCTCCCACCCTCCGG + Intronic
907308096 1:53524780-53524802 CTTACGCACCTGCTGCTCTTTGG + Exonic
909564419 1:77039109-77039131 CCCACCCACCTGCCTCCCACTGG + Intronic
912775955 1:112506676-112506698 CTCTCCCACCTGCCCCTCTCAGG + Intronic
915338985 1:155166174-155166196 CTCCCGCACCTCCCACCCCCAGG - Intergenic
920814622 1:209319724-209319746 CTCACACAACTGCCTCCTTCTGG - Intergenic
922025206 1:221742968-221742990 GTCACGCCCCTGCCGTCCCCAGG + Intergenic
923355869 1:233154992-233155014 CTCACCCAACTTCCACCCTCTGG - Intronic
924147027 1:241086981-241087003 CACACACTCCTGCAGCCCTCTGG + Intronic
1065013689 10:21442239-21442261 CTCAAGCATCTGCCTACCTCGGG - Intergenic
1065972860 10:30818828-30818850 CTCACGCAGGTCCTGCCCTCAGG - Intergenic
1069778063 10:70938247-70938269 CTCACTCACCTGCCCACCTGAGG - Intergenic
1077465661 11:2732638-2732660 CTCACGCAACTGCTGCCCCGTGG - Intronic
1080581834 11:33650749-33650771 CACACGCACCTGCCCCTCTCCGG + Intronic
1082095017 11:48122828-48122850 TTCAGGCCCCTGCAGCCCTCAGG + Intronic
1082928775 11:58578709-58578731 CGCGCGCACCTGCCTCCCTGAGG - Intergenic
1083301986 11:61744358-61744380 CTCATGGACCTGACGCCCACGGG + Exonic
1083596616 11:63920773-63920795 CTCCCTCCCCTGCCGCCCACTGG + Intergenic
1083961180 11:66015861-66015883 CTCCCGCTCCTGACTCCCTCCGG + Intergenic
1089346967 11:117796936-117796958 CCCACGCACCTGGAGCCCGCCGG + Intronic
1090333064 11:125946124-125946146 ATCACTCACCTGAGGCCCTCAGG - Intergenic
1092193190 12:6534610-6534632 CGCCCGCCCCTGCCGCCTTCAGG - Intronic
1092500901 12:9046025-9046047 CTCTCCCACCTGCCCCCCACAGG - Intergenic
1093744394 12:22723025-22723047 CTAACCCACATGCCTCCCTCAGG + Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096841166 12:54379826-54379848 TTCGTGCACCTGCTGCCCTCTGG + Intronic
1101901529 12:108794402-108794424 CTCTCCCTCCTGCCGCCCACTGG + Intronic
1102140865 12:110613993-110614015 CTCACCCAGGCGCCGCCCTCCGG + Intergenic
1102365538 12:112331143-112331165 CTCATGCAACTGCCGCCTCCCGG + Intronic
1103465826 12:121141316-121141338 CTCCTGCACCTGCAGGCCTCCGG + Intronic
1104358495 12:128110048-128110070 CTCCTGCACCTGCCTCCTTCAGG + Intergenic
1104865484 12:131950676-131950698 GTCACACACCTGCGGCCCACGGG + Intronic
1105240880 13:18609205-18609227 CTCAGGCACCGGCCGCGGTCGGG - Intergenic
1107964747 13:45588568-45588590 CTCACTCACCTGGTGCCCACTGG + Intronic
1112114712 13:96339458-96339480 CTCAAGCACCTTCTCCCCTCAGG - Intronic
1113593815 13:111518022-111518044 CTCCCTCACCTGCCCCCCCCCGG + Intergenic
1113593836 13:111518066-111518088 CTCCCTCACCTGCCCCCCCCCGG + Intergenic
1113881759 13:113630914-113630936 CTCACACACCTGGGCCCCTCTGG - Intronic
1116693232 14:48137698-48137720 CTCTCGCTCCTGCTGCCCTGTGG + Intergenic
1118776269 14:68976279-68976301 CTCACTCCCCTGCCTCCCTCTGG + Intronic
1120988568 14:90355179-90355201 CTCACCCGCCTGCCGCTCACTGG + Intergenic
1123162355 14:106290994-106291016 CTCACCCACCTGCTGTCCTGTGG + Intergenic
1123490478 15:20775934-20775956 CTCAGGCACCGGCCGCGGTCGGG + Intergenic
1123546979 15:21345021-21345043 CTCAGGCACCGGCCGCGGTCGGG + Intergenic
1123574776 15:21656009-21656031 GTCTCCCACATGCCGCCCTCAGG + Intergenic
1123611391 15:22098505-22098527 GTCTCCCACATGCCGCCCTCAGG + Intergenic
1124376648 15:29133003-29133025 CACACACCCCTGCCGCCTTCAGG + Intronic
1124401115 15:29348401-29348423 CTCACGTAGCTGCAGCCCTGCGG - Intronic
1125274885 15:37979286-37979308 CTCCTGCTCCTGCTGCCCTCAGG - Intergenic
1127007220 15:54583996-54584018 CTCGGGCTCCTGCCGCTCTCTGG + Intronic
1130403457 15:83578264-83578286 GTCAGCCACCTGCCTCCCTCCGG + Intronic
1130960889 15:88657947-88657969 CTGCCGCACCTGCTGCTCTCCGG - Intergenic
1131074929 15:89489577-89489599 CTCACCCACCTGCCTCCCAGGGG + Intronic
1131493676 15:92883417-92883439 CCCGCCCACCTGCCGCCCGCGGG - Intronic
1202955310 15_KI270727v1_random:72237-72259 CTCAGGCACCGGCCGCGGTCGGG + Intergenic
1202983643 15_KI270727v1_random:390261-390283 GTCTCCCACATGCCGCCCTCAGG + Intergenic
1132635992 16:946932-946954 CTCACCCACCTGCCAGGCTCTGG + Intronic
1132673178 16:1110218-1110240 CTCAGGCACCTGCCGCCTGTCGG - Intergenic
1132909132 16:2299365-2299387 CTCACGCCCCTGCCACCAGCAGG - Intronic
1133021464 16:2968795-2968817 CTCACGCGCCCGCAGCCGTCGGG - Intronic
1133051548 16:3120011-3120033 CTGAAGCACTTGCCGCACTCGGG - Exonic
1136052389 16:27661238-27661260 CTGACCCACCTGCCTCACTCAGG - Intronic
1136626643 16:31465909-31465931 CTGACGCACCTGCTGCTCTCTGG + Exonic
1140257030 16:73346292-73346314 CTCACGCACCTGGAACACTCTGG + Intergenic
1141448533 16:84080546-84080568 CACCCGCAGCTGCCACCCTCAGG + Intronic
1141797615 16:86285685-86285707 CACAGGTACCTGCCTCCCTCCGG - Intergenic
1142203362 16:88771510-88771532 CTCACGCAGCTGCTGGGCTCAGG + Intronic
1142211817 16:88811980-88812002 CTCACCCACGCTCCGCCCTCCGG - Intergenic
1142396998 16:89837691-89837713 CGCACGCACCTCCCGGACTCGGG + Intronic
1143127623 17:4654192-4654214 CTCACGCAACTTCCGTCTTCCGG - Intergenic
1143644726 17:8223000-8223022 CTCACGGACCAGCCTCCCCCAGG + Intergenic
1145243699 17:21253908-21253930 CTCACGCAGCTGAAGCCCTGGGG + Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG + Intergenic
1148863616 17:50617584-50617606 CCCACGCACCTGCCCTCCTAGGG + Intronic
1151599916 17:75099905-75099927 TTCACACACCTGCCCTCCTCTGG - Intronic
1154448090 18:14450703-14450725 CTCAGGCACCGGCCGCGGTCGGG + Intergenic
1157981975 18:52392297-52392319 CTCATGCAACTGCCACCCTTCGG - Intronic
1160791139 19:924296-924318 CTCAGACACCTGCCGCCATTAGG + Intergenic
1161046372 19:2136908-2136930 CACAGGCACCTGCTGCCCACAGG + Intronic
1161362769 19:3860446-3860468 CTCAAGAACCTGCCGCCCTATGG - Intronic
1161392456 19:4028519-4028541 CTCAGACACCAGCTGCCCTCAGG + Exonic
1163485078 19:17580655-17580677 GTCACTCTCCTCCCGCCCTCCGG - Intronic
1165157476 19:33796927-33796949 CCCACGCAGCTGCCGGTCTCGGG - Intronic
1166147723 19:40848795-40848817 CTCCTGCCCCTGCCGCCCCCTGG - Intronic
1166374594 19:42320474-42320496 CTCACACATCTTCTGCCCTCGGG - Intronic
1167405012 19:49300975-49300997 CTCACGCAACTTCCGCCTCCCGG - Intronic
1168146862 19:54424484-54424506 CTCTTGCACCTGCTGCCCTGCGG - Intronic
927263933 2:21123818-21123840 CGCACACAGCTTCCGCCCTCAGG + Intergenic
928235056 2:29531993-29532015 CACAGGCACCTGCAGCCCTCTGG - Exonic
929955401 2:46454376-46454398 CTCAGGGACCTGGCTCCCTCAGG + Intronic
934712806 2:96526924-96526946 CTCAGTCACATGCCGCCCTTGGG - Intergenic
935093275 2:99917268-99917290 CTCACTCTTCTGCCTCCCTCTGG + Intronic
936543178 2:113368602-113368624 CTCACCCACCTTCCAGCCTCTGG - Intergenic
944225685 2:197346615-197346637 CTCACGGACATCCCACCCTCTGG - Intergenic
945404121 2:209424210-209424232 CTCACGGACTTAGCGCCCTCCGG - Intronic
946085590 2:217168204-217168226 CTCACCCACCTTCCACCTTCAGG - Intergenic
947724043 2:232386608-232386630 CGCACCCTCCTCCCGCCCTCAGG + Intergenic
948115814 2:235493958-235493980 CCCGCGCGCTTGCCGCCCTCCGG - Intergenic
948790065 2:240372430-240372452 CTCTCCCACCTGCCCCTCTCAGG - Intergenic
1170146514 20:13181065-13181087 CCCAAGCACCTGCATCCCTCTGG + Intergenic
1170596070 20:17806869-17806891 CCCACGCAGCTCCCACCCTCTGG - Intergenic
1171519805 20:25766946-25766968 CTCCAGCACCAGCAGCCCTCTGG + Intronic
1171557114 20:26089547-26089569 CTCCAGCACCAGCAGCCCTCTGG - Intergenic
1171979831 20:31619913-31619935 CTCAGGCACCTGCCATCCCCTGG + Intergenic
1172875878 20:38164190-38164212 CTCAGCCACCTGCCTCCCTCGGG - Intronic
1172952539 20:38731120-38731142 CTCCCGCCCCTGCCACCCTCAGG - Intergenic
1174553623 20:51378794-51378816 CTCACACATCTGCCGCACACAGG - Intergenic
1175923936 20:62462890-62462912 CTCAGCCACCTGCCCCCCACTGG - Intergenic
1176140550 20:63542969-63542991 CTCCCACACCTTCCGCCCTTGGG + Intronic
1180051518 21:45333668-45333690 CTCACCCACTTCCCGCCCTGAGG + Intergenic
1180127574 21:45802698-45802720 CTCCTGCTCCTGCCTCCCTCAGG - Intronic
1180206410 21:46264116-46264138 CCTACGCAGCTGCCGCCCTGGGG - Exonic
1180537276 22:16404265-16404287 CTCCCCCACCCCCCGCCCTCTGG - Intergenic
1180797082 22:18611246-18611268 CTCACGCAGCTGGCGCTCCCGGG + Exonic
1180821526 22:18832270-18832292 AGCAGGCACCTGCTGCCCTCAGG - Intergenic
1180908359 22:19431560-19431582 CTCCCGCGCCACCCGCCCTCCGG + Exonic
1181051354 22:20239621-20239643 AGCAGGCACCTGTCGCCCTCAGG - Intergenic
1181191452 22:21143775-21143797 AGCAGGCACCTGCTGCCCTCAGG + Intergenic
1181207746 22:21266735-21266757 AGCAGGCACCTGCTGCCCTCAGG - Intergenic
1181224641 22:21384025-21384047 CTCACGCAGCTGGCGCTCCCGGG - Exonic
1181253991 22:21550788-21550810 CTCACGCAGCTGGCGCTCCCGGG + Exonic
1182118579 22:27772679-27772701 CTCACGCAGCTGCGCCCCTTTGG + Intronic
1183704622 22:39469128-39469150 CCCACCCACCTGCCCCCTTCTGG - Intronic
1184277695 22:43419587-43419609 CTAGAGCAGCTGCCGCCCTCAGG - Intronic
1184355906 22:43979464-43979486 CTCAGCCACCTGCCACCCACTGG + Intronic
1184521679 22:44998303-44998325 CTCACACACAGGCTGCCCTCTGG + Intronic
1185185777 22:49398802-49398824 TTCACCGACGTGCCGCCCTCTGG - Intergenic
1185408674 22:50671832-50671854 CTCACACACATGACGTCCTCTGG - Intergenic
1203219174 22_KI270731v1_random:28681-28703 AGCAGGCACCTGCTGCCCTCAGG + Intergenic
1203271651 22_KI270734v1_random:58146-58168 AGCAGGCACCTGCTGCCCTCAGG - Intergenic
949559507 3:5188403-5188425 CTAACGGCCCTGGCGCCCTCGGG - Intronic
950047082 3:9955166-9955188 CTCACACACCTGCCCTTCTCAGG - Intergenic
950113370 3:10434811-10434833 CTCACTCATCTGCCTCCTTCTGG - Intronic
954146105 3:48635108-48635130 CGCACGCAGCTGCCTCCCTGTGG + Intronic
961046490 3:123712107-123712129 CTCAGGCCCCTGCTGCTCTCTGG + Intronic
963600831 3:147377798-147377820 CTCACGCTCCTATCACCCTCAGG + Intergenic
964337881 3:155677169-155677191 CTCACCCACCTGTGGCCCTTAGG + Intronic
966851714 3:184168884-184168906 CTCACGATCCTGGCGCCCCCGGG - Intronic
966930479 3:184672521-184672543 GTCATGCACCTGCTGGCCTCTGG + Intronic
966970374 3:185040091-185040113 ATCACTCACCTCCCACCCTCAGG + Intronic
968443101 4:634367-634389 CTCACGCACCTGCCGCCCTCCGG - Intronic
968640802 4:1713451-1713473 CTTTTGCACCTGCTGCCCTCAGG + Intergenic
968981195 4:3850555-3850577 CCCAAGCTCCTGCTGCCCTCTGG + Intergenic
968982071 4:3855667-3855689 CTCACTCACCTTCCTCCTTCAGG + Intergenic
982380065 4:154740600-154740622 CCCTCGCACCTGCCGCGCTCAGG - Intronic
984114739 4:175665562-175665584 CTCAAACACCTCCTGCCCTCAGG - Intronic
985888210 5:2696569-2696591 CTCACACCCCTGCTGCCCTGTGG + Intergenic
990200996 5:53374165-53374187 CTCACACTCCTCCCACCCTCCGG - Intergenic
990581835 5:57173588-57173610 CTCCCGCACCTCCCCCCGTCCGG - Intergenic
997209402 5:132068632-132068654 CTCGCGCACCTGCATCCCCCTGG - Intergenic
998405086 5:141869697-141869719 CTCACCCACCTGACGCTCCCTGG + Intronic
1002176110 5:177402430-177402452 CTCACACACCAGCGGGCCTCCGG + Exonic
1002697432 5:181100356-181100378 CTCCCACCCTTGCCGCCCTCTGG + Intergenic
1003643923 6:7899031-7899053 CTCCACCACCTGCAGCCCTCTGG - Intronic
1005385254 6:25279315-25279337 CTCGCGCTCCTGCCGGGCTCCGG - Intronic
1005429662 6:25741987-25742009 CTCACCCAGCTGTGGCCCTCTGG - Intergenic
1007569394 6:42878712-42878734 CTCACGCAGCCTCCGCCTTCTGG + Intergenic
1015281542 6:131440178-131440200 CTCATGCACCTGCAGTCATCTGG + Intergenic
1015773485 6:136792063-136792085 CTCCTGCAGATGCCGCCCTCGGG + Exonic
1016321051 6:142846134-142846156 CACACTCCCCTGCCGCTCTCAGG - Intronic
1017000265 6:149991610-149991632 CTCCTGCCCCTGCCGCACTCAGG + Intergenic
1017010492 6:150060109-150060131 CTCCTGCCCCTGCCGCACTCAGG + Intergenic
1018705904 6:166462813-166462835 CTCACACGCATGCCTCCCTCTGG - Intronic
1019597541 7:1865147-1865169 CTCACGCATGTGCCCCCTTCCGG - Intronic
1022517853 7:30987240-30987262 CACACCCACCTGCCAGCCTCTGG - Intronic
1023246375 7:38209355-38209377 CTCACGCAACTGCCACCTCCTGG + Intronic
1024471727 7:49773668-49773690 CTCGCGCGCCGGCCGCGCTCCGG + Exonic
1034625042 7:152485978-152486000 CTCACGCAGTTTCCGCCCCCTGG + Intergenic
1034860158 7:154587948-154587970 GCCATGCACCTGCAGCCCTCAGG + Intronic
1035828296 8:2668198-2668220 CCCCCGCCCCTGCCACCCTCTGG - Intergenic
1036578828 8:10054400-10054422 CCCGCGCCCCTGCCGCCCCCCGG + Exonic
1036615133 8:10381885-10381907 CTCAGGCACCTGCCACTCTTGGG + Intronic
1037901658 8:22692486-22692508 CGCTCGCACCTACCTCCCTCCGG + Intronic
1039401692 8:37275336-37275358 ATCTAGCACCTGCCACCCTCGGG + Intergenic
1040997233 8:53414070-53414092 CGCACACACCTGCAGCCCTTGGG + Intergenic
1045509896 8:102806332-102806354 CTCCCCCTCCTCCCGCCCTCGGG + Intergenic
1046103959 8:109644910-109644932 CTCCCTCACCTGCGGCCTTCGGG + Intronic
1047613345 8:126542362-126542384 CTCATCCTCCTGCCTCCCTCTGG + Intergenic
1049566610 8:143343537-143343559 CTCAGGCCCCTCCCGGCCTCGGG + Intronic
1049646546 8:143738288-143738310 CTCATGGACCAGCCGGCCTCAGG + Intergenic
1049659882 8:143815182-143815204 CGCCCGCACCTGCCGCCCAAAGG - Intronic
1049770794 8:144380149-144380171 CTCAGACACCTGCTGCACTCAGG + Intronic
1049770802 8:144380203-144380225 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049770827 8:144380365-144380387 CTCAGGCACCTGCCGCAGTCAGG + Intronic
1049770836 8:144380419-144380441 CTCAGGCACCTGCTGCACTCAGG + Intronic
1049770843 8:144380473-144380495 CTCAGGCACCTGCTGCACTCAGG + Intronic
1049770850 8:144380527-144380549 CTCAGGCGCCTGCTGCACTCAGG + Intronic
1049770857 8:144380581-144380603 CTCAGGCGCCTGCTGCACTCAGG + Intronic
1049770864 8:144380635-144380657 CTCAGGCGCCTGCTGCACTCAGG + Intronic
1049770871 8:144380689-144380711 CTCAGGCACCTGCCGCACTAAGG + Intronic
1049770879 8:144380743-144380765 CTCAGGCACCTGCCCCACTCAGG + Intronic
1049770889 8:144380797-144380819 CTCAGGCACCTGCCCCACTCAGG + Intronic
1049770899 8:144380851-144380873 CTCAGGCACCTGCCGCACTAAGG + Intronic
1049770907 8:144380905-144380927 CTCAGGCACCTGCCCCACTCAGG + Intronic
1049770917 8:144380959-144380981 CTCAGGCACCTGCCCCACTCAGG + Intronic
1049770927 8:144381013-144381035 CTCAGGCACCTCCCGCAGTCAGG + Intronic
1049770935 8:144381067-144381089 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049770943 8:144381121-144381143 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049770951 8:144381175-144381197 CTCAGGCACCTGCTGCACTCAGG + Intronic
1049770959 8:144381229-144381251 CTCAGGCACCTGCCGCACTCAGG + Intronic
1049770967 8:144381283-144381305 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049770986 8:144381391-144381413 CTCAGGCACCTGCTGCACTCAGG + Intronic
1049770993 8:144381445-144381467 CTCAGGCACCTGCCGCACTCAGG + Intronic
1049771001 8:144381499-144381521 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049771010 8:144381553-144381575 CTCAGGCACCTGCCGCACTCAGG + Intronic
1049771019 8:144381607-144381629 CTCAGGCACCTCCCGCAGTCAGG + Intronic
1049771038 8:144381715-144381737 CTCAGGCACCTGCTGCACTCAGG + Intronic
1049771046 8:144381769-144381791 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049771056 8:144381823-144381845 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049771066 8:144381877-144381899 CTCAGGCCCCTGCCGCACTCAGG + Intronic
1049771077 8:144381931-144381953 CTCAGGCACCTGCCGCACTCAGG + Intronic
1049771086 8:144381985-144382007 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049771096 8:144382039-144382061 CTCAGGCCCCTGCTGCACTCAGG + Intronic
1049771106 8:144382093-144382115 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049771114 8:144382147-144382169 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049771122 8:144382201-144382223 CTCAGGCACCTGCTGCACTAAGG + Intronic
1049771130 8:144382255-144382277 CTCAGGCACCTGCCGCACTCAGG + Intronic
1053204048 9:36171618-36171640 CTCCAGCACCTGCTTCCCTCCGG + Intergenic
1053476326 9:38384540-38384562 CTCCCTCACCTGCTTCCCTCTGG + Intergenic
1056220708 9:84448290-84448312 CTGACCCTCCTGCCTCCCTCTGG - Intergenic
1060608663 9:124940962-124940984 CCCGCGCACCTGCCTCTCTCTGG + Exonic
1062681975 9:137787049-137787071 CTCTCTCACCTGCTGCCCTTCGG + Intronic
1185471676 X:387326-387348 CTCACACACCTCCCAGCCTCTGG - Intergenic
1189591559 X:42517865-42517887 CACAAGCAGCTGCCACCCTCAGG + Intergenic
1190237960 X:48631938-48631960 CTCAGGCACCTTCTGGCCTCCGG + Intergenic
1190862695 X:54358904-54358926 CTCCCCCACCTGCCACCATCAGG - Intergenic