ID: 968444918

View in Genome Browser
Species Human (GRCh38)
Location 4:647330-647352
Sequence GATTTGGGGTCCATCTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968444909_968444918 15 Left 968444909 4:647292-647314 CCAAAGCAGGGACTGGGGCAAAT 0: 1
1: 0
2: 3
3: 11
4: 182
Right 968444918 4:647330-647352 GATTTGGGGTCCATCTGGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968444918 Original CRISPR GATTTGGGGTCCATCTGGCC GGG Intronic
900472932 1:2863486-2863508 GATTTGGGGTGAATGTGGCCTGG - Intergenic
903524390 1:23981931-23981953 GATTTTGGGGCCACCTTGCCTGG - Intergenic
904279276 1:29407432-29407454 GATTCTGGATCCATCTGGTCTGG - Intergenic
904288935 1:29471355-29471377 GATTTGGGTTCAACCTGGGCAGG + Intergenic
904833395 1:33320020-33320042 CATTTGGGTTCCATTTGACCTGG + Intronic
905639081 1:39576391-39576413 GATTTGGTTTCCCTCTGCCCCGG - Exonic
907763986 1:57390007-57390029 GGTTTGGGGGCCAGGTGGCCTGG - Intronic
907968799 1:59360479-59360501 GTTTTGGGGTTCAAGTGGCCAGG + Intronic
911520010 1:98918181-98918203 GCTTTGGGGTCAAACTGGTCTGG + Intronic
912924934 1:113905387-113905409 GATTTGGGCTCCAGCGGGCAGGG + Exonic
914889146 1:151607395-151607417 GATTTGGGAGCCATCAGCCCTGG - Intergenic
914999637 1:152577204-152577226 GGTGTGGGGTCCATGTGGCAAGG + Intronic
915225154 1:154406155-154406177 CATTGGGGGTCCACCTCGCCTGG + Intronic
915458953 1:156058256-156058278 GATTTGGGGTCCCTAATGCCAGG + Intronic
915728441 1:158035665-158035687 GATTTGGGGTCAGACAGGCCTGG - Intronic
920713551 1:208317958-208317980 AATTAAGGGTCCATCTGCCCAGG + Intergenic
921944143 1:220875058-220875080 GATTTGGGGTCTTTCTTGGCTGG + Intergenic
922116415 1:222618171-222618193 GTGCTGGGGTCCAGCTGGCCCGG - Exonic
922560668 1:226567187-226567209 GATTTCAGGTCAATCTGGCCTGG - Intronic
1067177447 10:43960055-43960077 GCTCTGGGCTCCATCTGGCCGGG + Intergenic
1069793241 10:71036624-71036646 GATAAGGGTTCCACCTGGCCAGG - Intergenic
1071599961 10:86954224-86954246 GATGTGGGGCTCCTCTGGCCTGG + Intronic
1072994928 10:100234913-100234935 GTTTTGAGGTCCAACAGGCCTGG + Intronic
1074343082 10:112653490-112653512 GCTTAGGGATCAATCTGGCCTGG + Intronic
1074761907 10:116673339-116673361 GATTGGGGCTCCACCTGGCTTGG - Exonic
1077421247 11:2451030-2451052 GGTGTGGGGTCCATCTGAGCAGG + Intronic
1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG + Intronic
1083982455 11:66184043-66184065 GATTTGGGGTCTAACTAGTCAGG + Intronic
1084209610 11:67614965-67614987 GATCTGGGCAGCATCTGGCCAGG - Intergenic
1086153690 11:83641689-83641711 GATTTGGGGTGGATCTCTCCAGG + Intronic
1091841399 12:3623864-3623886 GATTTTGGTTCCCTCTGGGCTGG + Intronic
1094206457 12:27845241-27845263 ACTTTGGAGTCCATCTGACCTGG - Intergenic
1097744403 12:63285493-63285515 GTTTTGGGGTGCATCTGTGCAGG + Intergenic
1099397106 12:82154149-82154171 GTTGTGGGGTCCCTGTGGCCTGG - Intergenic
1101105922 12:101440156-101440178 GATTTTGGGTCCCCTTGGCCTGG + Intergenic
1103735425 12:123057960-123057982 GACTTGGGGCCCAGCTGGCACGG - Intronic
1103960287 12:124605270-124605292 CATTTGGCCTCCAGCTGGCCTGG - Intergenic
1105272648 13:18892567-18892589 CTTCTGGAGTCCATCTGGCCTGG - Intergenic
1106307803 13:28528938-28528960 GATTTGAGGTCCAGCTGCTCTGG - Intergenic
1106644498 13:31617698-31617720 GACTTGGGGGTCATCTGCCCTGG + Intergenic
1107963591 13:45579778-45579800 GGTTTGGGGTCCGTGTGCCCAGG + Intronic
1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG + Intergenic
1113150950 13:107263051-107263073 GTTTTGGTGACCATCTGTCCTGG + Intronic
1126693862 15:51309425-51309447 GAGTTGGGGGCCATCTGCCAAGG - Intronic
1127812895 15:62579988-62580010 GATCTGGGATCCTCCTGGCCAGG - Intronic
1127830209 15:62743781-62743803 GTTCTGGAGTCCTTCTGGCCAGG - Intronic
1128539317 15:68515369-68515391 GTTCTAGGGTCAATCTGGCCAGG + Intergenic
1128549074 15:68586027-68586049 GATTTGGGGTTCCACTGGCTAGG + Intronic
1128800825 15:70495858-70495880 GATTTGGTTTCCAGATGGCCTGG - Intergenic
1130960732 15:88657197-88657219 CATTTGGGACCCATCTTGCCGGG - Intergenic
1131303488 15:91220738-91220760 GATTTGGGGCCCATCAGGGCTGG - Intronic
1132486463 16:194667-194689 GATTTGTGGTCCACCTCCCCTGG - Intronic
1132678496 16:1130410-1130432 GGTCTGGGGTCCATCTGGCGAGG + Intergenic
1132708679 16:1257087-1257109 GACTTGGTGCCCACCTGGCCCGG - Intronic
1133268218 16:4597390-4597412 GATGTGGACTCCATCTGCCCTGG - Intronic
1133440415 16:5816433-5816455 AATTTGGGGTTCAGCTGGCATGG - Intergenic
1135831483 16:25778034-25778056 GATTGGGGGTCCATGTGGGTGGG + Intronic
1136037183 16:27549503-27549525 AATCTGGGGTCCCTCAGGCCTGG - Intronic
1138577883 16:57920228-57920250 GATTTGGGATCCATATGTACAGG - Intronic
1139790172 16:69427700-69427722 GAATTGGGGTCCCACTGGCTGGG + Intronic
1141125527 16:81398135-81398157 GAATTGGGGGCGATCTGGTCAGG - Intergenic
1143171583 17:4933669-4933691 AATTTGGGGTCCATCTAGGTGGG - Exonic
1143360935 17:6370611-6370633 CATTTGGGGCCCAAATGGCCAGG + Intergenic
1144457477 17:15430893-15430915 GAGGTGGGGTCCAGCAGGCCAGG + Intergenic
1145863548 17:28226579-28226601 GATTTGGGGTCCCACTGGATGGG - Intergenic
1146061277 17:29608756-29608778 GGTTTGGGATCCGTGTGGCCAGG - Intronic
1146259946 17:31414713-31414735 GCTTTGGAGTGCCTCTGGCCAGG - Intronic
1146658092 17:34646937-34646959 GATTCAGGTTCCATCTGGCCTGG + Intergenic
1146957946 17:36947840-36947862 GCTGTGGGATCCAACTGGCCCGG + Intergenic
1147020583 17:37529242-37529264 GGTTTGGGGCCCATCTAACCTGG - Intronic
1147908519 17:43839835-43839857 GACTTTGGGTCCATCTGGACAGG + Intergenic
1148734590 17:49858337-49858359 GATTTTAGGGCCCTCTGGCCAGG - Intergenic
1150435765 17:65153000-65153022 GCTTTGAGGTCCATGTGGTCTGG + Intronic
1151579288 17:74969034-74969056 GATTTGGTGACCACCTGCCCAGG + Intronic
1151829664 17:76542222-76542244 AATCTGAGGACCATCTGGCCAGG + Intronic
1152747961 17:82049893-82049915 GAGTGGGGGTCCAGCTGCCCGGG - Intronic
1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG + Intronic
1160539749 18:79614127-79614149 GAATCGGGTTCCATCTGCCCAGG + Intergenic
1160805399 19:990309-990331 GCTTTGGGGGCCCCCTGGCCCGG + Exonic
1160897215 19:1408371-1408393 AGTTTGGGGTCCCCCTGGCCAGG - Intronic
1161993951 19:7701155-7701177 GACTTGGGGTCCTTCAGGCCTGG + Intronic
1162031015 19:7917266-7917288 GATTTGGGGTCCTTAGGGGCTGG + Intronic
1163665078 19:18599474-18599496 GAATTGTGGGCCTTCTGGCCTGG - Intronic
1163675204 19:18652292-18652314 GAGTTGGGCTCCAGCAGGCCAGG + Intronic
1164473847 19:28557382-28557404 CAATTGGGGGCCTTCTGGCCAGG - Intergenic
1164492373 19:28727214-28727236 GACTTGGGGTCGCTCTGCCCCGG + Intergenic
1167160292 19:47763164-47763186 GAGGTGGCGTCCATGTGGCCAGG - Intergenic
1168046372 19:53797045-53797067 GATTAGGGCTACAGCTGGCCTGG + Intronic
925655897 2:6148811-6148833 GAGTTGGGGACCATCTGTACTGG + Intergenic
926150896 2:10425101-10425123 GACTGGAGGTCCATCTGGGCTGG + Intronic
926323852 2:11767532-11767554 GTTTTGGGTTCCATCTTTCCTGG + Intronic
927450331 2:23204201-23204223 GATTTGGGCTTCATCTTACCTGG + Intergenic
932220150 2:69993076-69993098 GATCTGGGGACCACGTGGCCAGG + Intergenic
933760060 2:85666819-85666841 GATTAGGGGTCAGTCTGCCCTGG - Intronic
934818423 2:97350778-97350800 GATTTGGGGGCTCTCTGCCCAGG + Intergenic
936279077 2:111122377-111122399 GATTTGAGGGCCGGCTGGCCCGG - Intronic
942932745 2:181515180-181515202 GATTTGAAGTCAATCTGACCTGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
947894484 2:233656763-233656785 TCTTTGGGGTCCCGCTGGCCAGG + Intronic
1168958931 20:1855059-1855081 GATTTCGGCCTCATCTGGCCAGG + Intergenic
1169033866 20:2433796-2433818 GAGATGGGGTTCACCTGGCCAGG - Intergenic
1170389286 20:15854313-15854335 GCTTTGGGGACCATATGGCAAGG + Intronic
1170942923 20:20863910-20863932 GATATGGGGCCCATCAAGCCAGG + Intergenic
1174583716 20:51591528-51591550 GAGTTGGGGACAATGTGGCCTGG - Intergenic
1174774468 20:53331440-53331462 GATTTTGGTTCCCCCTGGCCCGG - Intronic
1178268835 21:31170740-31170762 AAATTGGGGACCATCTGGCCAGG + Intronic
1181485909 22:23231725-23231747 TACTTGGGCACCATCTGGCCAGG + Intronic
1183342808 22:37291275-37291297 GACCTGGGCTCCATCTAGCCTGG + Intronic
1185159031 22:49211742-49211764 GATCCGGGCTCCATCTGGCCAGG + Intergenic
950135832 3:10580187-10580209 GATTTGGGGTCACACTGACCAGG - Intronic
952084215 3:29798033-29798055 GAGATGGGGAACATCTGGCCAGG + Intronic
955986677 3:64580945-64580967 GCTTTGGAGTCCATCAGGTCTGG + Intronic
957387734 3:79518973-79518995 GATTTGGAGACCATTTGGCCAGG - Intronic
960994021 3:123329394-123329416 GATATGTGGTGCATGTGGCCGGG - Intronic
963065010 3:141256725-141256747 GATTCGGTGTTCCTCTGGCCAGG + Intronic
963090157 3:141476562-141476584 GATTTGGGGGCTTTTTGGCCAGG + Intergenic
966271207 3:178108140-178108162 GATTTGAGGTAGGTCTGGCCAGG + Intergenic
968444918 4:647330-647352 GATTTGGGGTCCATCTGGCCGGG + Intronic
969294965 4:6264323-6264345 GACTTCTGGTCCAGCTGGCCTGG + Intergenic
969532708 4:7738774-7738796 GCTTTGGGGTCTGGCTGGCCGGG - Intronic
972405029 4:38737528-38737550 GATTTGAGGTCAGTTTGGCCGGG + Intergenic
976111157 4:81675166-81675188 GATTTGGAGTCCAACTCTCCTGG + Intronic
984947731 4:184983088-184983110 GGTTTGGGGACCAGCTGGCTGGG - Intergenic
985882085 5:2645959-2645981 TCTTTGGGGTCCCTTTGGCCGGG - Intergenic
999309065 5:150539883-150539905 TATTTGGGGTCAGTCAGGCCTGG + Intronic
1001529504 5:172452471-172452493 CTTTTGGGGTCCAGCGGGCCTGG + Intronic
1002405185 5:179024828-179024850 GACTTAGGGCCCCTCTGGCCTGG + Intronic
1004590491 6:17046946-17046968 CATATGGGTTCCAACTGGCCAGG + Intergenic
1007693089 6:43715569-43715591 GCTTTAGGGTTCATTTGGCCTGG - Intergenic
1007947039 6:45836087-45836109 GATTTGAGGTACATCTGTCCAGG + Intergenic
1013210421 6:107982163-107982185 GATTTCGGGTCGGTCTGACCAGG - Intergenic
1015516964 6:134092370-134092392 GATTTGGACTTCATCTGCCCTGG + Intergenic
1017927320 6:158921707-158921729 GATTTGGGTTTCATCTGGTTCGG + Intergenic
1019461562 7:1161637-1161659 GATTAGGCGACCATCTGGTCTGG - Intergenic
1021770508 7:23996163-23996185 GATTTGGAGTCCAAGTGACCTGG + Intergenic
1027691934 7:81358610-81358632 GATTTGGGGTCGACCTGATCAGG - Intergenic
1027997718 7:85447112-85447134 CATTAGGGGTACAGCTGGCCTGG - Intergenic
1028957312 7:96708676-96708698 GCTTTGGTGTCAATCAGGCCAGG + Intronic
1029487587 7:100852866-100852888 GCTGTGGGGTGCACCTGGCCGGG + Intronic
1029503196 7:100946523-100946545 GATCTGGGATCCATCTCCCCAGG + Intergenic
1030723592 7:112898570-112898592 GACTTGGGGTCCATCCCCCCAGG - Intronic
1032387431 7:131534315-131534337 GAGTTGGGGTCCCCCAGGCCTGG - Intronic
1035407077 7:158606084-158606106 TACTTGGGGTACAGCTGGCCAGG - Intergenic
1035728411 8:1838934-1838956 GGTGTGGGGGCCATCTGGCATGG + Intronic
1036072432 8:5456115-5456137 GATTTGGGGATTATCTGGCTTGG - Intergenic
1040831291 8:51680243-51680265 GATGTGGGGTGCATGTGGCTTGG + Intronic
1043319300 8:78962439-78962461 TCTTTGGGGTCGATATGGCCAGG - Intergenic
1047065686 8:121279775-121279797 TATTTGGAGTCCCTCTGACCTGG - Intergenic
1049148501 8:141019508-141019530 GATTTGGGAGCCATCAGGGCAGG - Intergenic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1054945755 9:70794449-70794471 GTCTTGGGGTCCATGTTGCCAGG - Intronic
1061477702 9:130880046-130880068 GACTTGGGTTTCATCTGTCCAGG + Exonic
1061483145 9:130907030-130907052 GATTTGGGGCCCTTCTGCCTGGG - Intronic
1185957809 X:4511304-4511326 GAATTGGGCTCAATCTGGCAGGG + Intergenic
1190120154 X:47652375-47652397 AATTTGAAGTCCATCAGGCCGGG - Intronic
1190657198 X:52622982-52623004 GATGTGGGGTCTATCAGTCCAGG - Intergenic
1195159053 X:102154133-102154155 GGTTTGGGCTCCACCTGCCCCGG - Exonic
1198486798 X:137095360-137095382 GGATTGGGGACCATCTGCCCTGG + Intergenic